Abo
  • Services:
Anzeige
Gene Life 2012: Auswertung und Hinweise für Lebensführung
Gene Life 2012: Auswertung und Hinweise für Lebensführung (Bild: Yahoo/Screenshot: Golem.de)

Wissenschaft: Yahoo verkauft in Japan Gentests

Gene Life 2012: Auswertung und Hinweise für Lebensführung
Gene Life 2012: Auswertung und Hinweise für Lebensführung (Bild: Yahoo/Screenshot: Golem.de)

Der Internetkonzern Yahoo steigt in Japan in das Geschäftsfeld Gesundheit ein: Das Unternehmen bietet zusammen mit einem Partner Gentests in dem asiatischen Land an.

Die Gentests für jedermann kommen voraussichtlich im Dezember in Japan auf den Markt. Mit ihrer Hilfe sollen die Käufer feststellen können, ob sie eine Disposition für bestimmte Krankheiten haben.

Die Käufer von Gene Life 2012 nehmen eine Speichelprobe und schicken sie an Genesis Healthcare, ein in Tokio ansässiges Unternehmen, das auf Gentests spezialisiert ist. Genesis Healthcare untersuche dann 68 Gene auf die Disposition von Krankheiten wie Diabetes, Schlaganfall oder Herzkrankheiten, berichtet die Tageszeitung Japan Times.

Anzeige

Auswertung und Hinweise

Die Nutzer erhalten von dem Unternehmen nach etwa zwei Monaten eine Auswertung des Tests. Außerdem werden Hinweise mitgeliefert, wie die Probanden ihr Leben so führen, dass sie das Risiko des Ausbruchs einer der Krankheiten verringern können.

Der Test soll rund 30.000 Yen, umgerechnet knapp 300 Euro, kosten. Yahoo will 300 Tests pro Monat absetzen. Der Konzern wird lediglich die Vermarktung übernehmen und mit den Gentests selbst nichts zu tun haben.


eye home zur Startseite
pholem 06. Nov 2012

Ahja, danke. http://www.heise.de/newsticker/meldung/Das-vermessene-Ich-Koerper-und...

attitudinized 03. Nov 2012

Also ich finde "Kunden mit Sequenz GATAAATCTGGTCTTTATTCC haben auch (...)gekauft." besser ;-)



Anzeige

Stellenmarkt
  1. SICK AG, Waldkirch bei Freiburg im Breisgau
  2. BG-Phoenics GmbH, München
  3. engram GmbH, Bremen
  4. M&C TechGroup Germany GmbH, Ratingen


Anzeige
Blu-ray-Angebote
  1. 1 Monat für 1€

Folgen Sie uns
       


  1. Luminar

    Lightroom-Konkurrenz bringt sich in Stellung

  2. Kleinrechner

    Tim Cook verspricht Update für Mac Mini

  3. Elektrorennwagen

    VW will elektrisch auf den Pikes Peak

  4. Messung

    Über 23.000 Funklöcher in Brandenburg

  5. Star Wars Battlefront 2 Angespielt

    Sternenkrieger-Kampagne rund um den Todesstern

  6. Nach Wahlniederlage

    Netzpolitiker Klingbeil soll SPD-Generalsekrektär werden

  7. Adasky

    Autonome Autos sollen im Infrarot-Bereich sehen

  8. Münsterland

    Deutsche Glasfaser baut weiter in Nordrhein-Westfalen aus

  9. Infineon

    BSI zertifiziert unsichere Verschlüsselung

  10. R-PHY- und R-MACPHY

    Kabelnetzbetreiber müssen sich nicht mehr festlegen



Haben wir etwas übersehen?

E-Mail an news@golem.de


Anzeige
APFS in High Sierra 10.13 im Test: Apple hat die MacOS-Dateisystem-Werkzeuge vergessen
APFS in High Sierra 10.13 im Test
Apple hat die MacOS-Dateisystem-Werkzeuge vergessen
  1. MacOS 10.13 Apple gibt High Sierra frei
  2. MacOS 10.13 High Sierra Wer eine SSD hat, muss auf APFS umstellen

Elex im Test: Schroffe Schale und postapokalyptischer Kern
Elex im Test
Schroffe Schale und postapokalyptischer Kern

Indiegames-Rundschau: Fantastische Fantasy und das Echo der Doppelgänger
Indiegames-Rundschau
Fantastische Fantasy und das Echo der Doppelgänger
  1. Verlag IGN übernimmt Indiegames-Anbieter Humble Bundle
  2. Indiegames-Rundschau Cyberpunk, Knetmännchen und Kampfsportkünstler
  3. Indiegames-Rundschau Fantasysport, Burgbelagerungen und ein amorpher Blob

  1. Re: Regierung kann die Betreiber nicht zwingen

    robinx999 | 07:26

  2. Re: 400-650g R1234yf pro Fahrzeug

    AllDayPiano | 07:23

  3. Re: Heult doch!

    whitbread | 07:19

  4. Re: Kurz: kann ein Pad nicht ersetzen

    cruse | 07:17

  5. Darum wird sich Linux nie so richtig durchsetzen

    AllDayPiano | 07:11


  1. 07:28

  2. 07:13

  3. 18:37

  4. 18:18

  5. 18:03

  6. 17:50

  7. 17:35

  8. 17:20


  1. Themen
  2. A
  3. B
  4. C
  5. D
  6. E
  7. F
  8. G
  9. H
  10. I
  11. J
  12. K
  13. L
  14. M
  15. N
  16. O
  17. P
  18. Q
  19. R
  20. S
  21. T
  22. U
  23. V
  24. W
  25. X
  26. Y
  27. Z
  28. #
 
    •  / 
    Zum Artikel