Abo
  • Services:
Anzeige
Gene Life 2012: Auswertung und Hinweise für Lebensführung
Gene Life 2012: Auswertung und Hinweise für Lebensführung (Bild: Yahoo/Screenshot: Golem.de)

Wissenschaft: Yahoo verkauft in Japan Gentests

Gene Life 2012: Auswertung und Hinweise für Lebensführung
Gene Life 2012: Auswertung und Hinweise für Lebensführung (Bild: Yahoo/Screenshot: Golem.de)

Der Internetkonzern Yahoo steigt in Japan in das Geschäftsfeld Gesundheit ein: Das Unternehmen bietet zusammen mit einem Partner Gentests in dem asiatischen Land an.

Die Gentests für jedermann kommen voraussichtlich im Dezember in Japan auf den Markt. Mit ihrer Hilfe sollen die Käufer feststellen können, ob sie eine Disposition für bestimmte Krankheiten haben.

Die Käufer von Gene Life 2012 nehmen eine Speichelprobe und schicken sie an Genesis Healthcare, ein in Tokio ansässiges Unternehmen, das auf Gentests spezialisiert ist. Genesis Healthcare untersuche dann 68 Gene auf die Disposition von Krankheiten wie Diabetes, Schlaganfall oder Herzkrankheiten, berichtet die Tageszeitung Japan Times.

Anzeige

Auswertung und Hinweise

Die Nutzer erhalten von dem Unternehmen nach etwa zwei Monaten eine Auswertung des Tests. Außerdem werden Hinweise mitgeliefert, wie die Probanden ihr Leben so führen, dass sie das Risiko des Ausbruchs einer der Krankheiten verringern können.

Der Test soll rund 30.000 Yen, umgerechnet knapp 300 Euro, kosten. Yahoo will 300 Tests pro Monat absetzen. Der Konzern wird lediglich die Vermarktung übernehmen und mit den Gentests selbst nichts zu tun haben.


eye home zur Startseite
pholem 06. Nov 2012

Ahja, danke. http://www.heise.de/newsticker/meldung/Das-vermessene-Ich-Koerper-und...

attitudinized 03. Nov 2012

Also ich finde "Kunden mit Sequenz GATAAATCTGGTCTTTATTCC haben auch (...)gekauft." besser ;-)



Anzeige

Stellenmarkt
  1. operational services GmbH & Co. KG, Berlin, Dresden
  2. Dürr Systems AG, Bietigheim-Bissingen
  3. Voith Digital Solutions GmbH, Heidenheim
  4. DEKRA SE, Stuttgart


Anzeige
Top-Angebote
  1. (50% Rabatt!)
  2. 219,00€ (Bestpreis!)
  3. (u. a. Gear VR 66,00€, Gear S3 277,00€)

Folgen Sie uns
       


  1. Komplett-PC

    In Nvidias Battleboxen steckt AMDs Ryzen

  2. Internet

    Cloudflare macht IPv6 parallel zu IPv4 jetzt Pflicht

  3. Square Enix

    Neustart für das Final Fantasy 7 Remake

  4. Agesa 1006

    Ryzen unterstützt DDR4-4000

  5. Telekom Austria

    Nokia erreicht 850 MBit/s im LTE-Netz

  6. Star Trek Bridge Crew im Test

    Festgetackert im Holodeck

  7. Quantenalgorithmen

    "Morgen könnte ein Physiker die Quantenmechanik widerlegen"

  8. Astra

    ZDF bleibt bis zum Jahr 2020 per Satellit in SD verfügbar

  9. Kubic

    Opensuse startet Projekt für Container-Plattform

  10. Frühstart

    Kabelnetzbetreiber findet keine Modems für Docsis 3.1



Haben wir etwas übersehen?

E-Mail an news@golem.de


Anzeige
Sphero Lightning McQueen: Erst macht es Brummbrumm, dann verdreht es die Augen
Sphero Lightning McQueen
Erst macht es Brummbrumm, dann verdreht es die Augen

Quantencomputer: Nano-Kühlung für Qubits
Quantencomputer
Nano-Kühlung für Qubits
  1. IBM Q Mehr Qubits von IBM
  2. Quantencomputer Was sind diese Qubits?
  3. Verschlüsselung Kryptographie im Quantenzeitalter

XPS 13 (9365) im Test: Dells Convertible zeigt alte Stärken und neue Schwächen
XPS 13 (9365) im Test
Dells Convertible zeigt alte Stärken und neue Schwächen
  1. Prozessor Intel wird Thunderbolt 3 in CPUs integrieren
  2. Schnittstelle Intel pflegt endlich Linux-Treiber für Thunderbolt
  3. Asus B9440 im Test Leichtes Geschäftsnotebook liefert zu wenig Business

  1. Re: Chipsätze nie angeboten???

    ldlx | 23:14

  2. Re: Warum nur? Fragen über Fragen!

    motzerator | 23:13

  3. Re: Zu breit

    Ember | 23:12

  4. Windows 10 das schlankeste Windows ?

    Multilindmikros... | 23:06

  5. Mobilfunk + Festnetz-Anschluss meiner Eltern

    __destruct() | 23:02


  1. 18:08

  2. 17:37

  3. 16:55

  4. 16:46

  5. 16:06

  6. 16:00

  7. 14:21

  8. 13:56


  1. Themen
  2. A
  3. B
  4. C
  5. D
  6. E
  7. F
  8. G
  9. H
  10. I
  11. J
  12. K
  13. L
  14. M
  15. N
  16. O
  17. P
  18. Q
  19. R
  20. S
  21. T
  22. U
  23. V
  24. W
  25. X
  26. Y
  27. Z
  28. #
 
    •  / 
    Zum Artikel