Abo
  • Services:
Anzeige
Gene Life 2012: Auswertung und Hinweise für Lebensführung
Gene Life 2012: Auswertung und Hinweise für Lebensführung (Bild: Yahoo/Screenshot: Golem.de)

Wissenschaft: Yahoo verkauft in Japan Gentests

Gene Life 2012: Auswertung und Hinweise für Lebensführung
Gene Life 2012: Auswertung und Hinweise für Lebensführung (Bild: Yahoo/Screenshot: Golem.de)

Der Internetkonzern Yahoo steigt in Japan in das Geschäftsfeld Gesundheit ein: Das Unternehmen bietet zusammen mit einem Partner Gentests in dem asiatischen Land an.

Die Gentests für jedermann kommen voraussichtlich im Dezember in Japan auf den Markt. Mit ihrer Hilfe sollen die Käufer feststellen können, ob sie eine Disposition für bestimmte Krankheiten haben.

Die Käufer von Gene Life 2012 nehmen eine Speichelprobe und schicken sie an Genesis Healthcare, ein in Tokio ansässiges Unternehmen, das auf Gentests spezialisiert ist. Genesis Healthcare untersuche dann 68 Gene auf die Disposition von Krankheiten wie Diabetes, Schlaganfall oder Herzkrankheiten, berichtet die Tageszeitung Japan Times.

Anzeige

Auswertung und Hinweise

Die Nutzer erhalten von dem Unternehmen nach etwa zwei Monaten eine Auswertung des Tests. Außerdem werden Hinweise mitgeliefert, wie die Probanden ihr Leben so führen, dass sie das Risiko des Ausbruchs einer der Krankheiten verringern können.

Der Test soll rund 30.000 Yen, umgerechnet knapp 300 Euro, kosten. Yahoo will 300 Tests pro Monat absetzen. Der Konzern wird lediglich die Vermarktung übernehmen und mit den Gentests selbst nichts zu tun haben.


eye home zur Startseite
pholem 06. Nov 2012

Ahja, danke. http://www.heise.de/newsticker/meldung/Das-vermessene-Ich-Koerper-und...

attitudinized 03. Nov 2012

Also ich finde "Kunden mit Sequenz GATAAATCTGGTCTTTATTCC haben auch (...)gekauft." besser ;-)



Anzeige

Stellenmarkt
  1. BEGO Medical GmbH Technologiepark Universität, Bremen
  2. MR Datentechnik Vertriebs- & Service GmbH, Nürnberg
  3. Rhenus Assets & Services GmbH & Co. KG, Holzwickede
  4. QSC AG, Köln


Anzeige
Spiele-Angebote
  1. 4,99€
  2. ab 129,99€
  3. 4,99€

Folgen Sie uns
       


  1. Neuer Mobilfunk

    Telekom-Chef nennt 5G-Ausbau "sehr teuer"

  2. Luftfahrt

    Nasa testet Überschallpassagierflugzeug im Windkanal

  3. Lenovo

    Moto Mod macht Moto Z zum Spiele-Handheld

  4. Alternatives Betriebssystem

    Jolla will Sailfish OS auf Sony-Smartphones bringen

  5. Gamesbranche

    PC-Plattform ist bei Spielentwicklern am beliebtesten

  6. Digitale Assistenten

    Google und Amazon kämpfen um Vorherrschaft

  7. Xperia Touch im Hands on

    Projektor macht jeden Tisch Android-tauglich

  8. RetroPie

    Distribution hat keine Rechte mehr am eigenen Namen

  9. Nokia 3310 im Hands on

    Der Nokia-Knochen mit Hipsterpotenzial

  10. Auto

    Macchina M2 bietet Zugriff auf Fahrzeugelektronik



Haben wir etwas übersehen?

E-Mail an news@golem.de


Anzeige
Galaxy-A-Serie vs. P8 Lite (2017): Samsungs und Huaweis Kampf um die Mittelklasse
Galaxy-A-Serie vs. P8 Lite (2017)
Samsungs und Huaweis Kampf um die Mittelklasse
  1. Wettbewerbsverstoß Google soll Tizen behindert haben
  2. Strafverfahren De-facto-Chef von Samsung wegen Korruption verhaftet
  3. Samsung Preisliches Niveau der QLED-Fernseher in der Nähe der OLEDs

Fire TV Stick 2 mit Alexa im Hands on: Amazons attraktiver Einstieg in die Streaming-Welt
Fire TV Stick 2 mit Alexa im Hands on
Amazons attraktiver Einstieg in die Streaming-Welt
  1. Fernsehstreaming Fire-TV-App von Waipu TV bietet alle Kanäle kostenlos
  2. Fire TV Amazon bringt Downloader-App wieder zurück
  3. Amazon Downloader-App aus dem Fire-TV-Store entfernt

Bodyhacking: Ich, einfach unverbesserlich
Bodyhacking
Ich, einfach unverbesserlich

  1. Re: Steam

    Iruwen | 16:42

  2. Re: "Selber Schuld"

    JohnStones | 16:41

  3. Re: Wozu?

    Chris0767 | 16:41

  4. Re: ein Mod geplant, mit dem sich das Smartphone...

    wonoscho | 16:39

  5. Re: War es schon "immer" und wird es auch bleiben

    QDOS | 16:38


  1. 16:32

  2. 16:12

  3. 15:33

  4. 14:31

  5. 14:21

  6. 14:16

  7. 13:30

  8. 12:49


  1. Themen
  2. A
  3. B
  4. C
  5. D
  6. E
  7. F
  8. G
  9. H
  10. I
  11. J
  12. K
  13. L
  14. M
  15. N
  16. O
  17. P
  18. Q
  19. R
  20. S
  21. T
  22. U
  23. V
  24. W
  25. X
  26. Y
  27. Z
  28. #
 
    •  / 
    Zum Artikel