Wissenschaft: Yahoo verkauft in Japan Gentests

Der Internetkonzern Yahoo steigt in Japan in das Geschäftsfeld Gesundheit ein: Das Unternehmen bietet zusammen mit einem Partner Gentests in dem asiatischen Land an.

Artikel veröffentlicht am ,
Gene Life 2012: Auswertung und Hinweise für Lebensführung
Gene Life 2012: Auswertung und Hinweise für Lebensführung (Bild: Yahoo/Screenshot: Golem.de)

Die Gentests für jedermann kommen voraussichtlich im Dezember in Japan auf den Markt. Mit ihrer Hilfe sollen die Käufer feststellen können, ob sie eine Disposition für bestimmte Krankheiten haben.

Stellenmarkt
  1. Go-to-Market Experte "New Work Produkte" (m/w/d)
    Haufe Group, Freiburg im Breisgau, Sankt Gallen (Home-Office möglich)
  2. IT-Support / Administrator / Developer für MS-Dynamics (m/w/d)
    Krannich Group GmbH, Stuttgart (Home-Office möglich)
Detailsuche

Die Käufer von Gene Life 2012 nehmen eine Speichelprobe und schicken sie an Genesis Healthcare, ein in Tokio ansässiges Unternehmen, das auf Gentests spezialisiert ist. Genesis Healthcare untersuche dann 68 Gene auf die Disposition von Krankheiten wie Diabetes, Schlaganfall oder Herzkrankheiten, berichtet die Tageszeitung Japan Times.

Auswertung und Hinweise

Die Nutzer erhalten von dem Unternehmen nach etwa zwei Monaten eine Auswertung des Tests. Außerdem werden Hinweise mitgeliefert, wie die Probanden ihr Leben so führen, dass sie das Risiko des Ausbruchs einer der Krankheiten verringern können.

Der Test soll rund 30.000 Yen, umgerechnet knapp 300 Euro, kosten. Yahoo will 300 Tests pro Monat absetzen. Der Konzern wird lediglich die Vermarktung übernehmen und mit den Gentests selbst nichts zu tun haben.

Bitte aktivieren Sie Javascript.
Oder nutzen Sie das Golem-pur-Angebot
und lesen Golem.de
  • ohne Werbung
  • mit ausgeschaltetem Javascript
  • mit RSS-Volltext-Feed


Aktuell auf der Startseite von Golem.de
PC-Hardware
Grafikkarten werden günstiger und besser verfügbar

Die Preise für Grafikkarten sind zuletzt gesunken, es gibt mehr Pixelbeschleuniger auf Lager. Das hat mehrere Gründe.

PC-Hardware: Grafikkarten werden günstiger und besser verfügbar
Artikel
  1. Razer Blade 14 im Test: Der dreifach einzigartige Ryzen-Laptop
    Razer Blade 14 im Test
    Der dreifach einzigartige Ryzen-Laptop

    Kompakter und flotter: Das Razer Blade 14 soll die Stärken des Urmodells mit der Performance aktueller Hardware vereinen - mit Erfolg.
    Ein Test von Marc Sauter

  2. Bundesdruckerei: Pilotbetrieb für digitale Schulzeugnisse gestartet
    Bundesdruckerei
    Pilotbetrieb für digitale Schulzeugnisse gestartet

    Das digitale Schulzeugnis soll vieles einfacher und sicherer machen, zunächst gehen drei Bundesländer mit IT-Experten in die Erprobung.

  3. Akkutechnik und E-Mobilität: Natrium-Ionen-Akkus werden echte Lithium-Alternative
    Akkutechnik und E-Mobilität
    Natrium-Ionen-Akkus werden echte Lithium-Alternative

    Faradion und der Tesla-Zulieferer CATL produzieren erste Natrium-Ionen-Akkus mit der Energiedichte von LFP. Sie sind kälteresistenter, sicherer und lithiumfrei.
    Von Frank Wunderlich-Pfeiffer

pholem 06. Nov 2012

Ahja, danke. http://www.heise.de/newsticker/meldung/Das-vermessene-Ich-Koerper-und...

Anonymer Nutzer 03. Nov 2012

Also ich finde "Kunden mit Sequenz GATAAATCTGGTCTTTATTCC haben auch (...)gekauft." besser ;-)


Folgen Sie uns
       


  • Schnäppchen, Rabatte und Top-Angebote
    Die besten Deals des Tages
    Schnäppchen • Orange Week bei Cyberport mit bis zu -70% • MSI Optix G32CQ4DE 335,99€ • XXL-Sale bei Alternate • Creative SB Z 69,99€ • SanDisk microSDXC 400 GB 39€ • Battlefield 4 Premium PC Code 7,49€ • Prime-Filme leihen für je 0,99€ • GP Anniversary Sale - Teil 4: Indie & Arcade • Saturn Weekend Deals [Werbung]
    •  /