Anzeige
Gene Life 2012: Auswertung und Hinweise für Lebensführung
Gene Life 2012: Auswertung und Hinweise für Lebensführung (Bild: Yahoo/Screenshot: Golem.de)

Wissenschaft Yahoo verkauft in Japan Gentests

Der Internetkonzern Yahoo steigt in Japan in das Geschäftsfeld Gesundheit ein: Das Unternehmen bietet zusammen mit einem Partner Gentests in dem asiatischen Land an.

Anzeige

Die Gentests für jedermann kommen voraussichtlich im Dezember in Japan auf den Markt. Mit ihrer Hilfe sollen die Käufer feststellen können, ob sie eine Disposition für bestimmte Krankheiten haben.

Die Käufer von Gene Life 2012 nehmen eine Speichelprobe und schicken sie an Genesis Healthcare, ein in Tokio ansässiges Unternehmen, das auf Gentests spezialisiert ist. Genesis Healthcare untersuche dann 68 Gene auf die Disposition von Krankheiten wie Diabetes, Schlaganfall oder Herzkrankheiten, berichtet die Tageszeitung Japan Times.

Auswertung und Hinweise

Die Nutzer erhalten von dem Unternehmen nach etwa zwei Monaten eine Auswertung des Tests. Außerdem werden Hinweise mitgeliefert, wie die Probanden ihr Leben so führen, dass sie das Risiko des Ausbruchs einer der Krankheiten verringern können.

Der Test soll rund 30.000 Yen, umgerechnet knapp 300 Euro, kosten. Yahoo will 300 Tests pro Monat absetzen. Der Konzern wird lediglich die Vermarktung übernehmen und mit den Gentests selbst nichts zu tun haben.


pholem 06. Nov 2012

Ahja, danke. http://www.heise.de/newsticker/meldung/Das-vermessene-Ich-Koerper-und...

attitudinized 03. Nov 2012

Also ich finde "Kunden mit Sequenz GATAAATCTGGTCTTTATTCC haben auch (...)gekauft." besser ;-)

Kommentieren



Anzeige

  1. Teamleiter Application Development (m/w)
    über 3C - Career Consulting Company GmbH, Frankfurt am Main
  2. Senior SRM Consultant Professional Services (m/w)
    über 3C - Career Consulting Company GmbH, Stuttgart
  3. Support Engineer (m/w)
    inatec Solutions GmbH, Frankfurt am Main
  4. Moodle-Administrator (m/w)
    Fachhochschule Südwestfalen, Hagen

Detailsuche


Blu-ray-Angebote
  1. San Andreas [Blu-ray]
    8,90€
  2. Das Leben des Brian - The Immaculate Edition [Blu-ray]
    7,90€
  3. Blu-rays je 9,97 EUR
    (u. a. Avatar, Blade Runner, Ziemlich beste Freunde, Corpse Bride)

Weitere Angebote


Folgen Sie uns
       


  1. Darpa

    Schnelle Drohnen fliegen durch Häuser

  2. Mattel und 3Doodler

    3D-Druck für Kinder

  3. Adobe Creative Cloud

    Adobe-Update löscht Daten auf dem Mac

  4. Verschlüsselung

    Thüringens Verfassungsschutzchef Kramer verlangt Hintertüren

  5. Xeon D-1571

    Intel veröffentlicht sparsamen Server-Chip mit 16 Kernen

  6. Die Woche im Video

    Sensationen und Skandale

  7. Micron

    Von 1Y-/1Z-DRAM-, 3D-Flash- und 3D-Xpoint-Plänen

  8. Hochbahn

    Hamburger Nahverkehr bekommt bald kostenloses WLAN

  9. ViaSat Joint Venture

    Eutelsat wird schnelleres Satelliten-Internet bieten

  10. SSDs

    Micron startet Serienfertigung von 3D-NAND-Flash



Haben wir etwas übersehen?

E-Mail an news@golem.de


Anzeige
Galaxy View im Test: Samsungs Riesentablet scheitert als Fernseher-Alternative
Galaxy View im Test
Samsungs Riesentablet scheitert als Fernseher-Alternative
  1. Lehrer IT-Ausstattung an Schulen weiterhin nicht gut
  2. Huawei Mediapad M2 10.0 Gut ausgestattetes 10-Zoll-Tablet mit Stylus für 500 Euro
  3. Oberschule Weiter zu wenig Computer an den Schulen

Staatliche Überwachung: Die Regierung liest jeden Post
Staatliche Überwachung
Die Regierung liest jeden Post
  1. ÖPNV in San Francisco Die meisten Überwachungskameras sind nur Attrappen
  2. Videoüberwachung Innenministerkonferenz will Body-Cams für alle Polizisten
  3. Schnüffelgesetz Vodafone warnt vor Backdoors im Mobilfunknetz

Unravel im Test: Feinwollig schön und frustig schwer
Unravel im Test
Feinwollig schön und frustig schwer
  1. The Witness im Test Die Insel der tausend Labyrinthe
  2. Oxenfree im Test Urlaub auf der Gruselinsel
  3. Amplitude im Test Beats und Groove auf Knopfdruck

  1. Re: echt oder hoax?

    77satellites | 16:09

  2. Re: 37500

    Neuro-Chef | 16:08

  3. Re: durchrechnen

    gaym0r | 16:08

  4. Re: solange kodi noch geht...

    Themenzersetzer | 16:07

  5. Re: W O W !

    Neuro-Chef | 16:04


  1. 14:35

  2. 13:25

  3. 12:46

  4. 11:03

  5. 09:21

  6. 09:03

  7. 00:24

  8. 18:25


  1. Themen
  2. A
  3. B
  4. C
  5. D
  6. E
  7. F
  8. G
  9. H
  10. I
  11. J
  12. K
  13. L
  14. M
  15. N
  16. O
  17. P
  18. Q
  19. R
  20. S
  21. T
  22. U
  23. V
  24. W
  25. X
  26. Y
  27. Z
  28. #
 
    •  / 
    Zum Artikel