Abo
  • Services:
Anzeige
Gene Life 2012: Auswertung und Hinweise für Lebensführung
Gene Life 2012: Auswertung und Hinweise für Lebensführung (Bild: Yahoo/Screenshot: Golem.de)

Wissenschaft: Yahoo verkauft in Japan Gentests

Gene Life 2012: Auswertung und Hinweise für Lebensführung
Gene Life 2012: Auswertung und Hinweise für Lebensführung (Bild: Yahoo/Screenshot: Golem.de)

Der Internetkonzern Yahoo steigt in Japan in das Geschäftsfeld Gesundheit ein: Das Unternehmen bietet zusammen mit einem Partner Gentests in dem asiatischen Land an.

Die Gentests für jedermann kommen voraussichtlich im Dezember in Japan auf den Markt. Mit ihrer Hilfe sollen die Käufer feststellen können, ob sie eine Disposition für bestimmte Krankheiten haben.

Die Käufer von Gene Life 2012 nehmen eine Speichelprobe und schicken sie an Genesis Healthcare, ein in Tokio ansässiges Unternehmen, das auf Gentests spezialisiert ist. Genesis Healthcare untersuche dann 68 Gene auf die Disposition von Krankheiten wie Diabetes, Schlaganfall oder Herzkrankheiten, berichtet die Tageszeitung Japan Times.

Anzeige

Auswertung und Hinweise

Die Nutzer erhalten von dem Unternehmen nach etwa zwei Monaten eine Auswertung des Tests. Außerdem werden Hinweise mitgeliefert, wie die Probanden ihr Leben so führen, dass sie das Risiko des Ausbruchs einer der Krankheiten verringern können.

Der Test soll rund 30.000 Yen, umgerechnet knapp 300 Euro, kosten. Yahoo will 300 Tests pro Monat absetzen. Der Konzern wird lediglich die Vermarktung übernehmen und mit den Gentests selbst nichts zu tun haben.


eye home zur Startseite
pholem 06. Nov 2012

Ahja, danke. http://www.heise.de/newsticker/meldung/Das-vermessene-Ich-Koerper-und...

attitudinized 03. Nov 2012

Also ich finde "Kunden mit Sequenz GATAAATCTGGTCTTTATTCC haben auch (...)gekauft." besser ;-)



Anzeige

Stellenmarkt
  1. Signavio GmbH, Berlin
  2. Landeshauptstadt München, München
  3. Deichmann SE, Essen
  4. über Ratbacher GmbH, München


Anzeige
Blu-ray-Angebote
  1. (u. a. Vier Fäuste für ein Halleluja, Zwei bärenstarke Typen,Vier Fäuste gegen Rio)
  2. 12,99€
  3. 125,00€

Folgen Sie uns
       


  1. Apple

    Aktivierungssperre des iPads lässt sich umgehen

  2. Amazon

    Downloader-App aus dem Fire-TV-Store entfernt

  3. Autonomes Fahren

    Apple zeigt Interesse an selbstfahrenden Autos

  4. Sicherheit

    Geheimdienst warnt vor Cyberattacke auf russische Banken

  5. Super Mario Bros. (1985)

    Fahrt ab auf den Bruder!

  6. Canon EOS 5D Mark IV im Test

    Grundsolides Arbeitstier mit einer Portion Extravaganz

  7. PSX 2016

    Sony hat The Last of Us 2 angekündigt

  8. Raspberry Pi

    Schutz gegen Übernahme durch Hacker und Botnetze verbessert

  9. UHD-Blu-ray

    PowerDVD spielt 4K-Discs

  10. Raumfahrt

    Europa bleibt im All



Haben wir etwas übersehen?

E-Mail an news@golem.de


Anzeige
Udacity: Selbstfahrendes Auto selbst programmieren
Udacity
Selbstfahrendes Auto selbst programmieren
  1. Strategiepapier EU fordert europaweite Standards für vernetzte Autos
  2. Autonomes Fahren Comma One veröffentlicht Baupläne für Geohot-Nachrüstsatz
  3. Autonomes Fahren Intel baut Prozessoren für Delphi und Mobileye

Oneplus 3T im Test: Schneller, ausdauernder und immer noch günstig
Oneplus 3T im Test
Schneller, ausdauernder und immer noch günstig
  1. Smartphone Oneplus 3T mit 128 GByte wird nicht zu Weihnachten geliefert
  2. Android-Smartphone Oneplus Three wird nach fünf Monaten eingestellt
  3. Oneplus 3T Oneplus bringt Three mit besserem Akku und SoC

Seoul-Incheon Ecobee ausprobiert: Eine sanfte Magnetbahnfahrt im Nirgendwo
Seoul-Incheon Ecobee ausprobiert
Eine sanfte Magnetbahnfahrt im Nirgendwo
  1. Transport Hyperloop One plant Trasse in Dubai

  1. vr

    userlast | 23:10

  2. Re: Lies ein Lexikon

    Moe479 | 23:09

  3. Re: hmm bullig sieht die jetzt nicht aus

    Thunderbird1400 | 23:08

  4. Re: Und man muss nicht mal

    Moe479 | 22:52

  5. Re: 4000¤ - WTF?

    happymeal | 22:51


  1. 12:54

  2. 11:56

  3. 10:54

  4. 10:07

  5. 08:59

  6. 08:00

  7. 00:03

  8. 15:33


  1. Themen
  2. A
  3. B
  4. C
  5. D
  6. E
  7. F
  8. G
  9. H
  10. I
  11. J
  12. K
  13. L
  14. M
  15. N
  16. O
  17. P
  18. Q
  19. R
  20. S
  21. T
  22. U
  23. V
  24. W
  25. X
  26. Y
  27. Z
  28. #
 
    •  / 
    Zum Artikel