Wissenschaft: Yahoo verkauft in Japan Gentests
Gene Life 2012: Auswertung und Hinweise für Lebensführung (Bild: Yahoo/Screenshot: Golem.de)

Wissenschaft Yahoo verkauft in Japan Gentests

Der Internetkonzern Yahoo steigt in Japan in das Geschäftsfeld Gesundheit ein: Das Unternehmen bietet zusammen mit einem Partner Gentests in dem asiatischen Land an.

Anzeige

Die Gentests für jedermann kommen voraussichtlich im Dezember in Japan auf den Markt. Mit ihrer Hilfe sollen die Käufer feststellen können, ob sie eine Disposition für bestimmte Krankheiten haben.

Die Käufer von Gene Life 2012 nehmen eine Speichelprobe und schicken sie an Genesis Healthcare, ein in Tokio ansässiges Unternehmen, das auf Gentests spezialisiert ist. Genesis Healthcare untersuche dann 68 Gene auf die Disposition von Krankheiten wie Diabetes, Schlaganfall oder Herzkrankheiten, berichtet die Tageszeitung Japan Times.

Auswertung und Hinweise

Die Nutzer erhalten von dem Unternehmen nach etwa zwei Monaten eine Auswertung des Tests. Außerdem werden Hinweise mitgeliefert, wie die Probanden ihr Leben so führen, dass sie das Risiko des Ausbruchs einer der Krankheiten verringern können.

Der Test soll rund 30.000 Yen, umgerechnet knapp 300 Euro, kosten. Yahoo will 300 Tests pro Monat absetzen. Der Konzern wird lediglich die Vermarktung übernehmen und mit den Gentests selbst nichts zu tun haben.


pholem 06. Nov 2012

Ahja, danke. http://www.heise.de/newsticker/meldung/Das-vermessene-Ich-Koerper-und...

attitudinized 03. Nov 2012

Also ich finde "Kunden mit Sequenz GATAAATCTGGTCTTTATTCC haben auch (...)gekauft." besser ;-)

Kommentieren



Anzeige

  1. Softwareentwickler / Developer / Programmierer C# (m/w)
    bayoonet AG, Darmstadt
  2. Softwaretester / Testautomatisierer (m/w)
    TONBELLER AG, Bensheim
  3. Senior Consultant SAP CRM / Solution Architect SAP CRM (m/w)
    Home Shopping Europe GmbH, Ismaning (Raum München)
  4. Consultant Finance Processes & Applications (m/w)
    Fresenius Netcare GmbH, Bad Homburg

 

Detailsuche


Folgen Sie uns
       


  1. Facebook, Google, Twitter

    Branchenweite Interessengruppe zum Open-Source-Einsatz

  2. Typ 007

    Leica Mittelformatkamera S filmt in 4K

  3. Cloud-Computing

    Mathematica Online für den Browser

  4. Taxi-Konkurrent

    Landgericht Frankfurt hebt Verbot von Uber auf

  5. Stadt München

    Zweiter Bürgermeister Münchens lobbyiert gegen Limux

  6. Wettbewerbsverfahren

    Justizminister Maas will an Googles Algorithmus

  7. Test Bernd das Brot

    "Dieses Spiel ist Mist"

  8. Apple

    Vorerst keine NFC-Funktion für deutsche iPhone-Käufer

  9. Sicherheitslücke bei Android

    AOSP-Browser soll über Javascript angreifbar sein

  10. Betriebssystem

    Apple bringt dritte öffentliche Beta von OS X 10.10



Haben wir etwas übersehen?

E-Mail an news@golem.de



NFC: Apple Pay könnte sich auszahlen
NFC
Apple Pay könnte sich auszahlen
  1. Visa Europe Verhandlungen für Apple Pay in Europa laufen
  2. Apple Smartwatch soll eigenen App Store bekommen
  3. Apple Digitale Geldbörse in iPhone 6 macht offenbar Fortschritte

Smartphone-Diebstahl: Sicher ist nur, wer schnell reagiert
Smartphone-Diebstahl
Sicher ist nur, wer schnell reagiert
  1. Android-Versionen Kitkat verbreitet sich langsamer als Jelly Bean
  2. Googles VoIP-Dienst Kostenlos telefonieren mit Hangouts für Android und iOS
  3. Android Wear Google will die Smartwatch klüger machen

NFC in der Analyse: Probleme und Chancen der Nahfunktechnik
NFC in der Analyse
Probleme und Chancen der Nahfunktechnik
  1. NFC iPhone 6 soll zum digitalen Portemonnaie werden
  2. Mini-PC Broadwell- und Braswell-NUCs laden Smartphones drahtlos

    •  / 
    Zum Artikel