Wissenschaft: Yahoo verkauft in Japan Gentests
Gene Life 2012: Auswertung und Hinweise für Lebensführung (Bild: Yahoo/Screenshot: Golem.de)

Wissenschaft Yahoo verkauft in Japan Gentests

Der Internetkonzern Yahoo steigt in Japan in das Geschäftsfeld Gesundheit ein: Das Unternehmen bietet zusammen mit einem Partner Gentests in dem asiatischen Land an.

Anzeige

Die Gentests für jedermann kommen voraussichtlich im Dezember in Japan auf den Markt. Mit ihrer Hilfe sollen die Käufer feststellen können, ob sie eine Disposition für bestimmte Krankheiten haben.

Die Käufer von Gene Life 2012 nehmen eine Speichelprobe und schicken sie an Genesis Healthcare, ein in Tokio ansässiges Unternehmen, das auf Gentests spezialisiert ist. Genesis Healthcare untersuche dann 68 Gene auf die Disposition von Krankheiten wie Diabetes, Schlaganfall oder Herzkrankheiten, berichtet die Tageszeitung Japan Times.

Auswertung und Hinweise

Die Nutzer erhalten von dem Unternehmen nach etwa zwei Monaten eine Auswertung des Tests. Außerdem werden Hinweise mitgeliefert, wie die Probanden ihr Leben so führen, dass sie das Risiko des Ausbruchs einer der Krankheiten verringern können.

Der Test soll rund 30.000 Yen, umgerechnet knapp 300 Euro, kosten. Yahoo will 300 Tests pro Monat absetzen. Der Konzern wird lediglich die Vermarktung übernehmen und mit den Gentests selbst nichts zu tun haben.


pholem 06. Nov 2012

Ahja, danke. http://www.heise.de/newsticker/meldung/Das-vermessene-Ich-Koerper-und...

attitudinized 03. Nov 2012

Also ich finde "Kunden mit Sequenz GATAAATCTGGTCTTTATTCC haben auch (...)gekauft." besser ;-)

Kommentieren



Anzeige

  1. Service Manager IT-Vertrieb (m/w)
    Daimler AG, Stuttgart
  2. System Engineer - Cloud Computing (m/w) - Schwerpunkt LAMP-Stack
    Syzygy Deutschland GmbH, Bad Homburg bei Frankfurt am Main
  3. Kaufmännischer Sachbearbeiter (m/w) im Bereich Zahlungsverkehr
    LogPay Financial Services GmbH, Eschborn
  4. Mitarbeiter/-in für Kundendatenmanagement in der Abteilung Marketing Kommunikation
    Daimler AG, Berlin

 

Detailsuche


Folgen Sie uns
       


  1. Daimler

    Mit eigener Hacker-Gruppe gegen Sicherheitslücken

  2. Android Wear

    Tesla Model S mit der Smartwatch bedienen

  3. iFixit

    Amazon Fire Phone ist nur schlecht zu reparieren

  4. Entwicklerstudio

    Crytek räumt finanzielle Probleme ein

  5. M-net

    Über 390 Kilometer Glasfaserkabel verlegt

  6. Bioelektronik

    Pilze sind die besten Zellschnittstellen

  7. Deanonymisierung

    Russland bietet 83.000 Euro für Enttarnung von Tor-Nutzern

  8. MyGlass

    Google-Glass-App offiziell in Deutschland verfügbar

  9. Google

    Youtube und der falsche Zeitstempel

  10. Western Digital

    Erste günstige 6-TByte-Festplatten sind verfügbar



Haben wir etwas übersehen?

E-Mail an news@golem.de


Anzeige
IMHO: Share Economy regulieren, nicht verbieten
IMHO
Share Economy regulieren, nicht verbieten
  1. NSA-Affäre Macht euch wichtig!
  2. IMHO Und wir sind selber schuld!
  3. Head Mounted Display Valve zeigt neue Version seiner VR-Brille

Privacy: Unsichtbares Tracking mit Bildern statt Cookies
Privacy
Unsichtbares Tracking mit Bildern statt Cookies
  1. Passenger Name Record Journalist findet seine Kreditkartendaten beim US-Zoll
  2. Android Zurücksetzen löscht Daten nur unvollständig
  3. Privatsphäre Bundesminister verlangt Datenschutz beim vernetzten Auto

PC-Spiele mit 4K, 6K, 8K, 15K: "Spielen mit Downsampling schlägt Full-HD immer"
PC-Spiele mit 4K, 6K, 8K, 15K
"Spielen mit Downsampling schlägt Full-HD immer"
  1. Transformers Ära des Untergangs - gefilmt mit Sensoren im Imax-Format
  2. Intel-Partnerschaft mit Samsung 4K-Monitore sollen unter 400 US-Dollar gedrückt werden
  3. Asus ROG Kleine Gaming-PCs im Konsolendesign mit Desktophardware

    •  / 
    Zum Artikel