Anzeige
Gene Life 2012: Auswertung und Hinweise für Lebensführung
Gene Life 2012: Auswertung und Hinweise für Lebensführung (Bild: Yahoo/Screenshot: Golem.de)

Wissenschaft Yahoo verkauft in Japan Gentests

Der Internetkonzern Yahoo steigt in Japan in das Geschäftsfeld Gesundheit ein: Das Unternehmen bietet zusammen mit einem Partner Gentests in dem asiatischen Land an.

Anzeige

Die Gentests für jedermann kommen voraussichtlich im Dezember in Japan auf den Markt. Mit ihrer Hilfe sollen die Käufer feststellen können, ob sie eine Disposition für bestimmte Krankheiten haben.

Die Käufer von Gene Life 2012 nehmen eine Speichelprobe und schicken sie an Genesis Healthcare, ein in Tokio ansässiges Unternehmen, das auf Gentests spezialisiert ist. Genesis Healthcare untersuche dann 68 Gene auf die Disposition von Krankheiten wie Diabetes, Schlaganfall oder Herzkrankheiten, berichtet die Tageszeitung Japan Times.

Auswertung und Hinweise

Die Nutzer erhalten von dem Unternehmen nach etwa zwei Monaten eine Auswertung des Tests. Außerdem werden Hinweise mitgeliefert, wie die Probanden ihr Leben so führen, dass sie das Risiko des Ausbruchs einer der Krankheiten verringern können.

Der Test soll rund 30.000 Yen, umgerechnet knapp 300 Euro, kosten. Yahoo will 300 Tests pro Monat absetzen. Der Konzern wird lediglich die Vermarktung übernehmen und mit den Gentests selbst nichts zu tun haben.


eye home zur Startseite
pholem 06. Nov 2012

Ahja, danke. http://www.heise.de/newsticker/meldung/Das-vermessene-Ich-Koerper-und...

attitudinized 03. Nov 2012

Also ich finde "Kunden mit Sequenz GATAAATCTGGTCTTTATTCC haben auch (...)gekauft." besser ;-)

Kommentieren



Anzeige

  1. Web / PHP Developer (m/w)
    emarsys interactive services GmbH, Berlin
  2. Informatiker, Wirtschaftsinformatiker als Sharepoint-Experte (m/w)
    HOBART GmbH, Offenburg
  3. Anwendungsbetreuer (m/w) Kundenservice (Nationale IT)
    ALDI SÜD, Mülheim an der Ruhr
  4. Java Developer - Partner Services (m/w)
    GK Software AG, Köln, Schöneck

Detailsuche



Anzeige
Blu-ray-Angebote
  1. Star Wars: Trilogie IV-VI [Blu-ray]
    33,00€
  2. VORBESTELLBAR: The Jungle Book 3D+ 2D [3D Blu-ray]
    27,99€ (Vorbesteller-Preisgarantie)
  3. Star Wars: The Complete Saga [9 Blu-rays]
    79,00€

Weitere Angebote


Folgen Sie uns
       


  1. VATM

    Vectoring in Mecklenburg-Vorpommern braucht 20.476 KVz

  2. Arkane Studios

    Dishonored 2 erscheint im November 2016

  3. OpenSSL-Update

    Die Rückkehr des Padding-Orakels

  4. Stellenabbau

    Mobilfunkentwicklung bei Nokia Stuttgart soll schließen

  5. HTC 10

    Update soll Schärfe bei Fotos verbessern

  6. Ratsch

    Google beantragt Patent auf zerreißbare Displays

  7. DNS:NET

    "Nicht jeder Kabelverzweiger bekommt Glasfaser von Telekom"

  8. Wileyfox Swift

    Cyanogen-OS-Smartphone für 140 Euro

  9. Liquid Jade Primo

    Acers Windows-10-Smartphone mit Continuum ist erschienen

  10. Bundeskriminalamt

    Geldfälscher sind zunehmend über das Netz aktiv



Haben wir etwas übersehen?

E-Mail an news@golem.de


Anzeige
Raspberry Pi 3 im ersten Test: Kein Grund zur Eile
Raspberry Pi 3 im ersten Test
Kein Grund zur Eile
  1. Pi Camera V2 Neues 8-Megapixel-Kameramodul für den Raspberry Pi
  2. IOT-Hat Funkaufsatz und Gamepad für den Raspberry Pi Zero
  3. 502IOT Das Über-Shield für den Raspberry Pi

Thermophotovoltaik: Die echte Sonne ist manchmal nicht gut genug
Thermophotovoltaik
Die echte Sonne ist manchmal nicht gut genug
  1. Solarflugzeug Solar Impulse startet wieder
  2. Erneuerbare Energien Solarzellen wandeln Regen in Strom
  3. Rollarray Solarstrom von der Rolle

Mitmachprojekt: Wie warm ist es in euren Büros?
Mitmachprojekt
Wie warm ist es in euren Büros?
  1. Mitmachprojekt Temperatur messen und versenden mit dem ESP8266
  2. Mitmachprojekt Temperatur messen und senden mit dem Particle Photon
  3. Mitmachprojekt Temperatur messen und senden mit dem Arduino

  1. ..sondern auf das Lesen von ein oder zwei Stunden...

    Psykhe | 06:03

  2. Re: Unprofesionell

    rakanitzu | 05:59

  3. Re: Deutsche Glasfaser

    M.P. | 05:56

  4. Re: "Anzeige"

    der_parlator | 05:55

  5. Ne wieso, Dein Märchen hör ich zum ersten Mal..

    Ovaron | 05:52


  1. 21:04

  2. 17:55

  3. 17:52

  4. 17:37

  5. 17:10

  6. 16:12

  7. 15:06

  8. 14:46


  1. Themen
  2. A
  3. B
  4. C
  5. D
  6. E
  7. F
  8. G
  9. H
  10. I
  11. J
  12. K
  13. L
  14. M
  15. N
  16. O
  17. P
  18. Q
  19. R
  20. S
  21. T
  22. U
  23. V
  24. W
  25. X
  26. Y
  27. Z
  28. #
 
    •  / 
    Zum Artikel