Abo
  • Services:
Anzeige
Gene Life 2012: Auswertung und Hinweise für Lebensführung
Gene Life 2012: Auswertung und Hinweise für Lebensführung (Bild: Yahoo/Screenshot: Golem.de)

Wissenschaft: Yahoo verkauft in Japan Gentests

Gene Life 2012: Auswertung und Hinweise für Lebensführung
Gene Life 2012: Auswertung und Hinweise für Lebensführung (Bild: Yahoo/Screenshot: Golem.de)

Der Internetkonzern Yahoo steigt in Japan in das Geschäftsfeld Gesundheit ein: Das Unternehmen bietet zusammen mit einem Partner Gentests in dem asiatischen Land an.

Die Gentests für jedermann kommen voraussichtlich im Dezember in Japan auf den Markt. Mit ihrer Hilfe sollen die Käufer feststellen können, ob sie eine Disposition für bestimmte Krankheiten haben.

Die Käufer von Gene Life 2012 nehmen eine Speichelprobe und schicken sie an Genesis Healthcare, ein in Tokio ansässiges Unternehmen, das auf Gentests spezialisiert ist. Genesis Healthcare untersuche dann 68 Gene auf die Disposition von Krankheiten wie Diabetes, Schlaganfall oder Herzkrankheiten, berichtet die Tageszeitung Japan Times.

Anzeige

Auswertung und Hinweise

Die Nutzer erhalten von dem Unternehmen nach etwa zwei Monaten eine Auswertung des Tests. Außerdem werden Hinweise mitgeliefert, wie die Probanden ihr Leben so führen, dass sie das Risiko des Ausbruchs einer der Krankheiten verringern können.

Der Test soll rund 30.000 Yen, umgerechnet knapp 300 Euro, kosten. Yahoo will 300 Tests pro Monat absetzen. Der Konzern wird lediglich die Vermarktung übernehmen und mit den Gentests selbst nichts zu tun haben.


eye home zur Startseite
pholem 06. Nov 2012

Ahja, danke. http://www.heise.de/newsticker/meldung/Das-vermessene-Ich-Koerper-und...

attitudinized 03. Nov 2012

Also ich finde "Kunden mit Sequenz GATAAATCTGGTCTTTATTCC haben auch (...)gekauft." besser ;-)



Anzeige

Stellenmarkt
  1. Bosch Communication Center Magdeburg GmbH, Magdeburg
  2. Planet Sports GmbH, München
  3. Landeskreditbank Baden-Württemberg -Förderbank-, Karlsruhe
  4. IT-Dienstleistungszentrum Berlin, Berlin


Anzeige
Top-Angebote
  1. (u. a. Die Unfassbaren, Der unglaubliche Hulk, Nightcrawler, Olympus Has Fallen, Die Verurteilten...
  2. 35,19€ (Bestpreis!)

Folgen Sie uns
       


  1. Quadro P6000/P5000

    Nvidia kündigt Profi-Karten mit GP02-Vollausbau an

  2. Jahresgehalt

    Erfahrene Softwareentwickler verdienen 55.500 Euro

  3. Sync 3

    Ford bringt Carplay und Android Auto in alle 2017er-Modelle

  4. Netzwerk

    Mehrere regionale Mobilfunkausfälle bei Vodafone

  5. Hello Games

    No Man's Sky braucht kein Plus und keine Superformel

  6. Master Key

    Hacker gelangen per Reverse Engineering an Gepäckschlüssel

  7. 3D-Druck

    Polizei will Smartphone mit nachgemachtem Finger entsperren

  8. Modesetting

    Debian und Ubuntu verzichten auf Intels X11-Treiber

  9. Elementary OS Loki im Test

    Hübsch und einfach kann auch kompliziert sein

  10. Mobilfunkausrüster

    Ericsson feuert seinen Konzernchef



Haben wir etwas übersehen?

E-Mail an news@golem.de


Anzeige
Festplatten mit Flash-Cache: Das Konzept der SSHD ist gescheitert
Festplatten mit Flash-Cache
Das Konzept der SSHD ist gescheitert
  1. Ironwolf, Skyhawk und Barracuda Drei neue 10-TByte-Modelle von Seagate
  2. 3PAR-Systeme HPE kündigt 7,68- und 15,36-TByte-SSDs an
  3. Dells XPS 13 mit Ubuntu im Test Endlich ein Top-Notebook mit Linux!

Nuki Smart Lock im Test: Ausgesperrt statt aufgesperrt
Nuki Smart Lock im Test
Ausgesperrt statt aufgesperrt

Xiaomi Mi Band 2 im Hands on: Fitness-Preisbrecher mit Hack-App
Xiaomi Mi Band 2 im Hands on
Fitness-Preisbrecher mit Hack-App
  1. Xiaomi Hugo Barra verkündet Premium-Smartphone
  2. Redmi 3S Xiaomis neues Smartphone kostet umgerechnet 95 Euro
  3. Mi Band 2 Xiaomis neues Fitness-Armband mit Pulsmesser kostet 20 Euro

  1. Re: 40000 als Einsteiger ist normal, sogar 45000...

    trapperjohn | 06:36

  2. Re: Gleicher Name = das letzte

    Helites | 06:19

  3. Re: Schon wieder das Märchen von den IT-Gehältern

    mkhorne | 06:17

  4. Welches Spiel haben die Mörder in Ansbach...

    AlBundy666 | 05:20

  5. Re: Ein Fingerabdruck ist KEIN Passwort

    Alashazz | 05:04


  1. 22:45

  2. 18:35

  3. 17:31

  4. 17:19

  5. 15:58

  6. 15:15

  7. 14:56

  8. 12:32


  1. Themen
  2. A
  3. B
  4. C
  5. D
  6. E
  7. F
  8. G
  9. H
  10. I
  11. J
  12. K
  13. L
  14. M
  15. N
  16. O
  17. P
  18. Q
  19. R
  20. S
  21. T
  22. U
  23. V
  24. W
  25. X
  26. Y
  27. Z
  28. #
 
    •  / 
    Zum Artikel