Anzeige
Gene Life 2012: Auswertung und Hinweise für Lebensführung
Gene Life 2012: Auswertung und Hinweise für Lebensführung (Bild: Yahoo/Screenshot: Golem.de)

Wissenschaft Yahoo verkauft in Japan Gentests

Der Internetkonzern Yahoo steigt in Japan in das Geschäftsfeld Gesundheit ein: Das Unternehmen bietet zusammen mit einem Partner Gentests in dem asiatischen Land an.

Anzeige

Die Gentests für jedermann kommen voraussichtlich im Dezember in Japan auf den Markt. Mit ihrer Hilfe sollen die Käufer feststellen können, ob sie eine Disposition für bestimmte Krankheiten haben.

Die Käufer von Gene Life 2012 nehmen eine Speichelprobe und schicken sie an Genesis Healthcare, ein in Tokio ansässiges Unternehmen, das auf Gentests spezialisiert ist. Genesis Healthcare untersuche dann 68 Gene auf die Disposition von Krankheiten wie Diabetes, Schlaganfall oder Herzkrankheiten, berichtet die Tageszeitung Japan Times.

Auswertung und Hinweise

Die Nutzer erhalten von dem Unternehmen nach etwa zwei Monaten eine Auswertung des Tests. Außerdem werden Hinweise mitgeliefert, wie die Probanden ihr Leben so führen, dass sie das Risiko des Ausbruchs einer der Krankheiten verringern können.

Der Test soll rund 30.000 Yen, umgerechnet knapp 300 Euro, kosten. Yahoo will 300 Tests pro Monat absetzen. Der Konzern wird lediglich die Vermarktung übernehmen und mit den Gentests selbst nichts zu tun haben.


eye home zur Startseite
pholem 06. Nov 2012

Ahja, danke. http://www.heise.de/newsticker/meldung/Das-vermessene-Ich-Koerper-und...

attitudinized 03. Nov 2012

Also ich finde "Kunden mit Sequenz GATAAATCTGGTCTTTATTCC haben auch (...)gekauft." besser ;-)

Kommentieren



Anzeige

  1. IT-Supporter/in
    WALDORF FROMMER, München
  2. Senior Information Security Lead (m/w)
    TUI Business Services GmbH, Hannover oder Crawley (England)
  3. Webentwickler/-in
    ALPLA Werke Alwin Lehner GmbH & Co KG, Hard (Österreich)
  4. SAP Anwendungsberater SD/CS (m/w)
    SICK AG, Waldkirch bei Freiburg im Breisgau

Detailsuche



Anzeige

Folgen Sie uns
       


  1. Zcryptor

    Neue Ransomware verbreitet sich auch über USB-Sticks

  2. LTE-Nachfolger

    Huawei schließt praktische Tests für Zukunftsmobilfunk ab

  3. Beam

    Neues Modul für Raumstation klemmt

  4. IT-Sicherheit

    SWIFT-Hack vermutlich größer als bislang angenommen

  5. Windows 10

    Microsoft bringt verdoppelten Virenschutz

  6. Audience Network

    Facebook trackt auch Nichtnutzer für Werbezwecke

  7. Statt Fernsehen

    Ministerrat will europaweite 700-MHz-Freigabe für Breitband

  8. Gran Turismo Sport

    Ein Bündnis mit der Realität

  9. Fensens Parksensor

    Einparken mit dem Smartphone

  10. Telefónica

    Microsoft und Facebook bauen 160-TBit/s-Seekabel nach Europa



Haben wir etwas übersehen?

E-Mail an news@golem.de


Anzeige
GPD XD im Test: Zwischen Nintendo 3DS und PS Vita ist noch Platz
GPD XD im Test
Zwischen Nintendo 3DS und PS Vita ist noch Platz
  1. Playstation 4 Rennstart für Gran Turismo Sport im November 2016
  2. Project Spark Microsoft stellt seinen Spieleeditor ein
  3. AMD Drei Konsolen-Chips für 2017 angekündigt

Intels Compute Stick im Test: Der mit dem Lüfter streamt (2)
Intels Compute Stick im Test
Der mit dem Lüfter streamt (2)
  1. Apple Store Apple darf keine Geschäfte in Indien eröffnen
  2. Prozessoren Intel soll in Deutschland Abbau von 350 Stellen planen
  3. HBM2 eSilicon zeigt 14LPP-Design mit High Bandwidth Memory

Xiaomi Mi5 im Test: Das fast perfekte Top-Smartphone
Xiaomi Mi5 im Test
Das fast perfekte Top-Smartphone
  1. Konkurrenz zu DJI Xiaomi mit Kampfpreis für Mi-Drohne
  2. YI 4K Xiaomi greift mit 4K-Actionkamera GoPro an

  1. Re: Sauregurkenzeit..?

    Adra | 07:45

  2. Re: Adblocker sind die besseren Antiviren

    unbuntu | 07:42

  3. Re: Ein Betriebssystem...

    unbuntu | 07:39

  4. Re: Vegetarisch ernähren

    unbuntu | 07:35

  5. Re: Interessiert mich schon lange nicht mehr...

    Adra | 07:30


  1. 17:09

  2. 16:15

  3. 15:51

  4. 15:21

  5. 15:12

  6. 14:28

  7. 14:17

  8. 14:08


  1. Themen
  2. A
  3. B
  4. C
  5. D
  6. E
  7. F
  8. G
  9. H
  10. I
  11. J
  12. K
  13. L
  14. M
  15. N
  16. O
  17. P
  18. Q
  19. R
  20. S
  21. T
  22. U
  23. V
  24. W
  25. X
  26. Y
  27. Z
  28. #
 
    •  / 
    Zum Artikel