Gene Life 2012: Auswertung und Hinweise für Lebensführung
Gene Life 2012: Auswertung und Hinweise für Lebensführung (Bild: Yahoo/Screenshot: Golem.de)

Wissenschaft Yahoo verkauft in Japan Gentests

Der Internetkonzern Yahoo steigt in Japan in das Geschäftsfeld Gesundheit ein: Das Unternehmen bietet zusammen mit einem Partner Gentests in dem asiatischen Land an.

Anzeige

Die Gentests für jedermann kommen voraussichtlich im Dezember in Japan auf den Markt. Mit ihrer Hilfe sollen die Käufer feststellen können, ob sie eine Disposition für bestimmte Krankheiten haben.

Die Käufer von Gene Life 2012 nehmen eine Speichelprobe und schicken sie an Genesis Healthcare, ein in Tokio ansässiges Unternehmen, das auf Gentests spezialisiert ist. Genesis Healthcare untersuche dann 68 Gene auf die Disposition von Krankheiten wie Diabetes, Schlaganfall oder Herzkrankheiten, berichtet die Tageszeitung Japan Times.

Auswertung und Hinweise

Die Nutzer erhalten von dem Unternehmen nach etwa zwei Monaten eine Auswertung des Tests. Außerdem werden Hinweise mitgeliefert, wie die Probanden ihr Leben so führen, dass sie das Risiko des Ausbruchs einer der Krankheiten verringern können.

Der Test soll rund 30.000 Yen, umgerechnet knapp 300 Euro, kosten. Yahoo will 300 Tests pro Monat absetzen. Der Konzern wird lediglich die Vermarktung übernehmen und mit den Gentests selbst nichts zu tun haben.


pholem 06. Nov 2012

Ahja, danke. http://www.heise.de/newsticker/meldung/Das-vermessene-Ich-Koerper-und...

attitudinized 03. Nov 2012

Also ich finde "Kunden mit Sequenz GATAAATCTGGTCTTTATTCC haben auch (...)gekauft." besser ;-)

Kommentieren



Anzeige

  1. Wissenschaftliche Mitarbeiterin / Wissenschaftlicher Mitarbeiter an der Juniorprofessur für Sicherheit in Informationssystemen
    Universität Passau, Passau
  2. IT-Administrator Second Level Support (m/w)
    Honda R&D Europe (Deutschland) GmbH über PME - Personal- und Managemententwicklung, Offenbach am Main
  3. Java-Experte / Software-Entwickler (m/w)
    Diehl Metering Systems GmbH, Nürnberg
  4. Senior Manager (m/w) Information Services for Germany / Austria
    Sanofi Pasteur MSD, Berlin

 

Detailsuche


Hardware-Angebote
  1. Medion Erazer X7835 PCGH-Notebook mit Geforce GTX 980M und Core i7-4710MQ
    1999,00€
  2. PCGH-Supreme-PC GTX980-Edition
    (Core i7-4790K + Geforce GTX 980)
  3. Dell 24-Zoll-Ultra-HD-Monitor
    529,90€

 

Weitere Angebote


Folgen Sie uns
       


  1. Chaton

    Samsung schaltet seinen Messenger ab

  2. Lehrreiche Geschenke

    Stille Nacht, Bastelnacht

  3. Samsung NX300

    Unabhängige Firmware verschlüsselt Fotos

  4. Arbeiter in China

    BBC findet schlechte Arbeitsbedingungen bei Apple-Zulieferer

  5. Misfortune Cookie

    Sicherheitslücke in Routern angeblich weit verbreitet

  6. Deutscher Entwicklerpreis 2014 Summit

    Das dreifache Balancing für den E-Sport

  7. Sicherheitssystem

    Volvo will Fahrradfahrer mit der Cloud schützen

  8. Security

    Schwere Sicherheitslücke im Git-Client

  9. Lumia Denim

    Verteilung von Windows-Phone-Update hat begonnen

  10. i8-Smartphone

    Linshof erliegt dem (T)Rubel



Haben wir etwas übersehen?

E-Mail an news@golem.de



Jahresrückblick: Was 2014 bei Golem.de los war
Jahresrückblick
Was 2014 bei Golem.de los war
  1. In eigener Sache Golem.de sucht (Junior) Concepter/-in für Onlinewerbung
  2. In eigener Sache Golem.de offline und unplugged
  3. In eigener Sache Golem.de sucht Videoredakteur/-in

E-Mail-Ausfall in München: Und wieder wars nicht Limux
E-Mail-Ausfall in München
Und wieder wars nicht Limux
  1. Öffentliche Verwaltung Massiver E-Mail-Ausfall bei der Stadt München
  2. Limux Kopf einziehen und über Verschwörung tuscheln
  3. Limux Windows-Rückkehr würde München Millionen kosten

Nexus 6 gegen Moto X: Das Nexus ist tot
Nexus 6 gegen Moto X
Das Nexus ist tot
  1. Teardown Nexus 6 kommt mit wenig Kleber aus
  2. Google Nexus 6 kommt doch erst viel später
  3. Google Nexus 6 erscheint nächste Woche - doch nicht

    •  / 
    Zum Artikel