Gene Life 2012: Auswertung und Hinweise für Lebensführung
Gene Life 2012: Auswertung und Hinweise für Lebensführung (Bild: Yahoo/Screenshot: Golem.de)

Wissenschaft Yahoo verkauft in Japan Gentests

Der Internetkonzern Yahoo steigt in Japan in das Geschäftsfeld Gesundheit ein: Das Unternehmen bietet zusammen mit einem Partner Gentests in dem asiatischen Land an.

Anzeige

Die Gentests für jedermann kommen voraussichtlich im Dezember in Japan auf den Markt. Mit ihrer Hilfe sollen die Käufer feststellen können, ob sie eine Disposition für bestimmte Krankheiten haben.

Die Käufer von Gene Life 2012 nehmen eine Speichelprobe und schicken sie an Genesis Healthcare, ein in Tokio ansässiges Unternehmen, das auf Gentests spezialisiert ist. Genesis Healthcare untersuche dann 68 Gene auf die Disposition von Krankheiten wie Diabetes, Schlaganfall oder Herzkrankheiten, berichtet die Tageszeitung Japan Times.

Auswertung und Hinweise

Die Nutzer erhalten von dem Unternehmen nach etwa zwei Monaten eine Auswertung des Tests. Außerdem werden Hinweise mitgeliefert, wie die Probanden ihr Leben so führen, dass sie das Risiko des Ausbruchs einer der Krankheiten verringern können.

Der Test soll rund 30.000 Yen, umgerechnet knapp 300 Euro, kosten. Yahoo will 300 Tests pro Monat absetzen. Der Konzern wird lediglich die Vermarktung übernehmen und mit den Gentests selbst nichts zu tun haben.


pholem 06. Nov 2012

Ahja, danke. http://www.heise.de/newsticker/meldung/Das-vermessene-Ich-Koerper-und...

attitudinized 03. Nov 2012

Also ich finde "Kunden mit Sequenz GATAAATCTGGTCTTTATTCC haben auch (...)gekauft." besser ;-)

Kommentieren



Anzeige

  1. Senior Software Developer .Net (m/w)
    Traxon Technologies Europe GmbH, Paderborn
  2. Dynamics NAV Entwickler (m/w)
    teamix GmbH, Nürnberg
  3. Consultant Daten- und Prozessmanagement im Energiehandel (m/w)
    Seven2one Informationssysteme GmbH, Karlsruhe
  4. Business Analyst (m/w) für Online Communication Systems
    HAMBURG SÜD Schifffahrtsgruppe, Hamburg

 

Detailsuche


Folgen Sie uns
       


  1. Bewegungsprofile

    Dobrindt wegen "Verkehrs-Vorratsdatenspeicherung" kritisiert

  2. Anonymisierung

    Facebook ist im Tor-Netzwerk erreichbar

  3. Spielekonsole

    Neuer 20-nm-Chip für sparsamere Xbox One ist fertig

  4. Günther Oettinger

    EU-Digitalkommissar will Urheberrechtssteuer für alle

  5. Ruhemodus

    Noch ein Bug in Firmware 2.0 der Playstation 4

  6. VDSL2-Nachfolgestandard

    Telekom-Konkurrenten starten G.fast-Praxistest

  7. Ego-Shooter

    Bethesda hat Prey 2 eingestellt

  8. Keine Bußgelder

    Sicherheitslücken bleiben ohne Strafen

  9. Kinox.to

    GVU will Bitshare und Freakshare offline nehmen lassen

  10. Bungie

    Destiny und der Gesundheitsbalken



Haben wir etwas übersehen?

E-Mail an news@golem.de



Moore's Law: Totgesagte schrumpfen länger
Moore's Law
Totgesagte schrumpfen länger

OS X Yosemite im Test: Continuity macht den Mac zum iPhone-Helfer
OS X Yosemite im Test
Continuity macht den Mac zum iPhone-Helfer
  1. OS X 10.10 Yosemite ist da
  2. Betriebssystem Apple bringt dritte öffentliche Beta von OS X 10.10
  3. Apple OS X Yosemite - die zweite öffentliche Beta ist da

Samsung Galaxy Note 4 im Test: Ausdauerndes Riesen-Smartphone mit Top-Hardware
Samsung Galaxy Note 4 im Test
Ausdauerndes Riesen-Smartphone mit Top-Hardware
  1. Galaxy Note 4 4,5 Millionen verkaufte Geräte in einem Monat
  2. Samsung Galaxy Note 4 wird teurer und kommt früher
  3. Gapgate Spalt im Samsung Galaxy Note 4 ist gewollt

    •  / 
    Zum Artikel