Abo
  • Services:
Anzeige
Gene Life 2012: Auswertung und Hinweise für Lebensführung
Gene Life 2012: Auswertung und Hinweise für Lebensführung (Bild: Yahoo/Screenshot: Golem.de)

Wissenschaft: Yahoo verkauft in Japan Gentests

Gene Life 2012: Auswertung und Hinweise für Lebensführung
Gene Life 2012: Auswertung und Hinweise für Lebensführung (Bild: Yahoo/Screenshot: Golem.de)

Der Internetkonzern Yahoo steigt in Japan in das Geschäftsfeld Gesundheit ein: Das Unternehmen bietet zusammen mit einem Partner Gentests in dem asiatischen Land an.

Die Gentests für jedermann kommen voraussichtlich im Dezember in Japan auf den Markt. Mit ihrer Hilfe sollen die Käufer feststellen können, ob sie eine Disposition für bestimmte Krankheiten haben.

Die Käufer von Gene Life 2012 nehmen eine Speichelprobe und schicken sie an Genesis Healthcare, ein in Tokio ansässiges Unternehmen, das auf Gentests spezialisiert ist. Genesis Healthcare untersuche dann 68 Gene auf die Disposition von Krankheiten wie Diabetes, Schlaganfall oder Herzkrankheiten, berichtet die Tageszeitung Japan Times.

Anzeige

Auswertung und Hinweise

Die Nutzer erhalten von dem Unternehmen nach etwa zwei Monaten eine Auswertung des Tests. Außerdem werden Hinweise mitgeliefert, wie die Probanden ihr Leben so führen, dass sie das Risiko des Ausbruchs einer der Krankheiten verringern können.

Der Test soll rund 30.000 Yen, umgerechnet knapp 300 Euro, kosten. Yahoo will 300 Tests pro Monat absetzen. Der Konzern wird lediglich die Vermarktung übernehmen und mit den Gentests selbst nichts zu tun haben.


eye home zur Startseite
pholem 06. Nov 2012

Ahja, danke. http://www.heise.de/newsticker/meldung/Das-vermessene-Ich-Koerper-und...

attitudinized 03. Nov 2012

Also ich finde "Kunden mit Sequenz GATAAATCTGGTCTTTATTCC haben auch (...)gekauft." besser ;-)



Anzeige

Stellenmarkt
  1. Neoperl GmbH, Müllheim
  2. T-Systems International GmbH, Bonn, Frankfurt am Main, Leinfelden-Echterdingen, München
  3. GIGATRONIK München GmbH, München
  4. Continental AG, Markdorf


Anzeige
Top-Angebote
  1. 49,90€ (Vergleichspreis: 62,90€)
  2. 59,90€ (Vergleichspreis: 71,30€)

Folgen Sie uns
       


  1. Linux

    Kernel-Sicherheitsinitiative wächst "langsam aber stetig"

  2. VR-Handschuh

    Dexta Robotics' Exoskelett für Motion Capturing

  3. Dragonfly 44

    Eine Galaxie fast ganz aus dunkler Materie

  4. Gigabit-Breitband

    Google Fiber soll Alphabet zu teuer sein

  5. Google-Steuer

    EU-Kommission plädiert für europäisches Leistungsschutzrecht

  6. Code-Gründer Thomas Bachem

    "Wir wollen weg vom Frontalunterricht"

  7. Pegasus

    Ausgeklügelte Spyware attackiert gezielt iPhones

  8. Fenix Chronos

    Garmins neue Sport-Smartwatch kostet ab 1.000 Euro

  9. C-94

    Cratoni baut vernetzten Fahrradhelm mit Crash-Sensor

  10. Hybridluftschiff

    Airlander 10 streifte Überlandleitung



Haben wir etwas übersehen?

E-Mail an news@golem.de


Anzeige
Next Gen Memory: So soll der Speicher der nahen Zukunft aussehen
Next Gen Memory
So soll der Speicher der nahen Zukunft aussehen
  1. Arbeitsspeicher DDR5 nähert sich langsam der Marktreife
  2. SK Hynix HBM2-Stacks mit 4 GByte ab dem dritten Quartal verfügbar
  3. Arbeitsspeicher Crucial liefert erste NVDIMMs mit DDR4 aus

Wiper Blitz 2.0 im Test: Kein spießiges Rasenmähen mehr am Samstag (Teil 2)
Wiper Blitz 2.0 im Test
Kein spießiges Rasenmähen mehr am Samstag (Teil 2)
  1. Softrobotik Oktopus-Roboter wird mit Gas angetrieben
  2. Warenzustellung Schweizer Post testet autonome Lieferroboter
  3. Lockheed Martin Roboter Spider repariert Luftschiffe

8K- und VR-Bilder in Rio 2016: Wenn Olympia zur virtuellen Realität wird
8K- und VR-Bilder in Rio 2016
Wenn Olympia zur virtuellen Realität wird
  1. 400 MBit/s Telefónica und Huawei starten erstes deutsches 4.5G-Netz
  2. Medienanstalten Analoge TV-Verbreitung bindet hohe Netzkapazitäten
  3. Mehr Programme Vodafone Kabel muss Preise für HD-Einspeisung senken

  1. Re: Ich empfehle an dieser Stelle: The Truth...

    Proctrap | 01:56

  2. Re: Und der Rest ist Zuckerwatte

    johnsonmonsen | 01:47

  3. Re: iOS, na klar!

    plutoniumsulfat | 01:17

  4. Re: Diebstahl leicht gemacht

    plutoniumsulfat | 01:12

  5. Re: Oder einfach USB kabel

    plutoniumsulfat | 01:08


  1. 15:33

  2. 15:17

  3. 14:29

  4. 12:57

  5. 12:30

  6. 12:01

  7. 11:57

  8. 10:40


  1. Themen
  2. A
  3. B
  4. C
  5. D
  6. E
  7. F
  8. G
  9. H
  10. I
  11. J
  12. K
  13. L
  14. M
  15. N
  16. O
  17. P
  18. Q
  19. R
  20. S
  21. T
  22. U
  23. V
  24. W
  25. X
  26. Y
  27. Z
  28. #
 
    •  / 
    Zum Artikel