Gene Life 2012: Auswertung und Hinweise für Lebensführung
Gene Life 2012: Auswertung und Hinweise für Lebensführung (Bild: Yahoo/Screenshot: Golem.de)

Wissenschaft Yahoo verkauft in Japan Gentests

Der Internetkonzern Yahoo steigt in Japan in das Geschäftsfeld Gesundheit ein: Das Unternehmen bietet zusammen mit einem Partner Gentests in dem asiatischen Land an.

Anzeige

Die Gentests für jedermann kommen voraussichtlich im Dezember in Japan auf den Markt. Mit ihrer Hilfe sollen die Käufer feststellen können, ob sie eine Disposition für bestimmte Krankheiten haben.

Die Käufer von Gene Life 2012 nehmen eine Speichelprobe und schicken sie an Genesis Healthcare, ein in Tokio ansässiges Unternehmen, das auf Gentests spezialisiert ist. Genesis Healthcare untersuche dann 68 Gene auf die Disposition von Krankheiten wie Diabetes, Schlaganfall oder Herzkrankheiten, berichtet die Tageszeitung Japan Times.

Auswertung und Hinweise

Die Nutzer erhalten von dem Unternehmen nach etwa zwei Monaten eine Auswertung des Tests. Außerdem werden Hinweise mitgeliefert, wie die Probanden ihr Leben so führen, dass sie das Risiko des Ausbruchs einer der Krankheiten verringern können.

Der Test soll rund 30.000 Yen, umgerechnet knapp 300 Euro, kosten. Yahoo will 300 Tests pro Monat absetzen. Der Konzern wird lediglich die Vermarktung übernehmen und mit den Gentests selbst nichts zu tun haben.


pholem 06. Nov 2012

Ahja, danke. http://www.heise.de/newsticker/meldung/Das-vermessene-Ich-Koerper-und...

attitudinized 03. Nov 2012

Also ich finde "Kunden mit Sequenz GATAAATCTGGTCTTTATTCC haben auch (...)gekauft." besser ;-)

Kommentieren



Anzeige

  1. IT-Mitarbeiter / innen Technische Servicestationen
    Landeshauptstadt München, München
  2. Embedded Software Engineer (m/w)
    GIGATRONIK Technologies AG, Wil SG (Schweiz)
  3. IT-Administrator/MS Dynamics NAV Systembetreuer (m/w)
    EMK Münzen & Edelmetalle, Erftstadt
  4. SAP-FI/CO-Inhouse-Berater (m/w)
    Zott SE & Co. KG, Mertingen Raum Augsburg

 

Detailsuche


Blu-ray-Angebote
  1. In Time/Runner Runner [Blu-ray]
    7,97€
  2. Dokumentationen zum Sonderpreis
    (u. a. Home, Wilde Inseln, Led Zeppelin)
  3. TOPSELLER: Game of Thrones - Die komplette 5. Staffel [Blu-ray]
    39,99€ inkl. Vorbestellerpreisgarantie

 

Weitere Angebote


Folgen Sie uns
       


  1. One Earth Message

    Bilder und Töne für Außerirdische

  2. Tropico 5

    Espionage mit El Presidente

  3. Tessel

    Offenes Entwicklerboard soll wie Io.js verwaltet werden

  4. Hack auf Datingplattform

    Sexuelle Vorlieben von Millionen Menschen veröffentlicht

  5. Angriff auf kritische Infrastrukturen

    Bundestag, bitte melden!

  6. Mark Shuttleworth

    Canonical erwägt offenbar Börsengang

  7. Amazon

    Fire TV Stick für 29 Euro

  8. Umfrage

    US-Bürger misstrauen Regierung beim Umgang mit Daten

  9. Mozilla

    Firefox personalisiert Werbung mit Browserverlauf

  10. Tracking auf Unternehmensseiten

    Verbraucherschützern gefällt der Gefällt-mir-Knopf nicht



Haben wir etwas übersehen?

E-Mail an news@golem.de



Apps für Googles Cardboard: Her mit der Pappe!
Apps für Googles Cardboard
Her mit der Pappe!
  1. Game of Thrones Auf der Mauer weht ein eisiger Wind
  2. VR im Journalismus So nah, dass es fast wehtut
  3. Deep angespielt "Atme tief ein und tauche durch die virtuelle Welt"

BND-Selektorenaffäre: Die stille Löschaktion des W. O.
BND-Selektorenaffäre
Die stille Löschaktion des W. O.
  1. BND-Chef Schindler "Wir sind abhängig von der NSA"
  2. BND-Metadatensuche "Die Nadel im Heuhaufen ist zerbrochen"
  3. NSA Streit um Selektoren-Liste zwischen Gabriel und Steinmeier

SSD HyperX Predator im Test: Kingstons Mischung ist gelungen
SSD HyperX Predator im Test
Kingstons Mischung ist gelungen
  1. Z-Drive 6300 Neue SSD bietet bis zu 6,4 TByte Speicherplatz
  2. Crucial BX100 und MX200 im Test Mehr SSD pro Euro gibt's derzeit nicht
  3. Plextor M6e Black Edition im Kurztest Auch eine günstige SSD kann teuer erkauft sein

  1. Re: Underground 2 ist das beste NFS

    FrankHausheimer | 03:04

  2. Re: Früher gerne, heute Protest gegen EA

    FrankHausheimer | 02:59

  3. Re: Arbeit und Schweiß kann Talent nicht ersetzen

    Oxycodon | 02:58

  4. Re: wenn du 18.000¤ dafür ausgegeben hast

    JimJim | 02:53

  5. Re: "Geheimdienste ... müssten also einen Anwalt...

    FreiGeistler | 02:44


  1. 18:43

  2. 15:32

  3. 15:26

  4. 15:09

  5. 14:21

  6. 14:08

  7. 13:54

  8. 13:44


  1. Themen
  2. A
  3. B
  4. C
  5. D
  6. E
  7. F
  8. G
  9. H
  10. I
  11. J
  12. K
  13. L
  14. M
  15. N
  16. O
  17. P
  18. Q
  19. R
  20. S
  21. T
  22. U
  23. V
  24. W
  25. X
  26. Y
  27. Z
  28. #
 
    •  / 
    Zum Artikel