Abo
  • Services:
Anzeige
Gene Life 2012: Auswertung und Hinweise für Lebensführung
Gene Life 2012: Auswertung und Hinweise für Lebensführung (Bild: Yahoo/Screenshot: Golem.de)

Wissenschaft: Yahoo verkauft in Japan Gentests

Gene Life 2012: Auswertung und Hinweise für Lebensführung
Gene Life 2012: Auswertung und Hinweise für Lebensführung (Bild: Yahoo/Screenshot: Golem.de)

Der Internetkonzern Yahoo steigt in Japan in das Geschäftsfeld Gesundheit ein: Das Unternehmen bietet zusammen mit einem Partner Gentests in dem asiatischen Land an.

Die Gentests für jedermann kommen voraussichtlich im Dezember in Japan auf den Markt. Mit ihrer Hilfe sollen die Käufer feststellen können, ob sie eine Disposition für bestimmte Krankheiten haben.

Die Käufer von Gene Life 2012 nehmen eine Speichelprobe und schicken sie an Genesis Healthcare, ein in Tokio ansässiges Unternehmen, das auf Gentests spezialisiert ist. Genesis Healthcare untersuche dann 68 Gene auf die Disposition von Krankheiten wie Diabetes, Schlaganfall oder Herzkrankheiten, berichtet die Tageszeitung Japan Times.

Anzeige

Auswertung und Hinweise

Die Nutzer erhalten von dem Unternehmen nach etwa zwei Monaten eine Auswertung des Tests. Außerdem werden Hinweise mitgeliefert, wie die Probanden ihr Leben so führen, dass sie das Risiko des Ausbruchs einer der Krankheiten verringern können.

Der Test soll rund 30.000 Yen, umgerechnet knapp 300 Euro, kosten. Yahoo will 300 Tests pro Monat absetzen. Der Konzern wird lediglich die Vermarktung übernehmen und mit den Gentests selbst nichts zu tun haben.


eye home zur Startseite
pholem 06. Nov 2012

Ahja, danke. http://www.heise.de/newsticker/meldung/Das-vermessene-Ich-Koerper-und...

attitudinized 03. Nov 2012

Also ich finde "Kunden mit Sequenz GATAAATCTGGTCTTTATTCC haben auch (...)gekauft." besser ;-)



Anzeige

Stellenmarkt
  1. SCHOTT AG, Mainz
  2. macio GmbH, Kiel und Karlsruhe
  3. VISHAY ELECTRONIC GmbH, Selb bei Hof
  4. ADAC SE, München


Anzeige
Top-Angebote
  1. (mehr als 2.500 reduzierte Titel)
  2. (u. a. The Hateful 8, Der Marsianer, London Has Fallen, Kingsman, Avatar)
  3. (Rabattcode: MB10)

Folgen Sie uns
       


  1. Raumfahrt

    Chang'e 5 fliegt zum Mond und wieder zurück

  2. Android 7.0

    Sony stoppt Nougat-Update für bestimmte Xperia-Geräte

  3. Dark Souls 3 The Ringed City

    Mit gigantischem Drachenschild ans Ende der Welt

  4. HTTPS

    Weiterhin rund 200.000 Systeme für Heartbleed anfällig

  5. Verkehrsexperten

    Smartphone-Nutzung am Steuer soll strenger geahndet werden

  6. Oracle

    Java entzieht MD5 und SHA-1 das Vertrauen

  7. Internetzensur

    China macht VPN genehmigungspflichtig

  8. Hawkeye

    ZTE will bei mediokrem Community-Smartphone nachbessern

  9. Valve

    Steam erhält Funktion, um Spiele zu verschieben

  10. Anet A6 im Test

    Wenn ein 3D-Drucker so viel wie seine Teile kostet



Haben wir etwas übersehen?

E-Mail an news@golem.de


Anzeige
Autonomes Fahren: Wenn die Strecke dem Zug ein Telegramm schickt
Autonomes Fahren
Wenn die Strecke dem Zug ein Telegramm schickt
  1. Fahrgastverband "WLAN im Zug funktioniert ordentlich"
  2. Deutsche Bahn WLAN im ICE wird kostenlos
  3. Mobilfunk Telekom baut LTE an Regionalbahnstrecken aus

GPD Win im Test: Crysis in der Hosentasche
GPD Win im Test
Crysis in der Hosentasche
  1. Digitale Assistenten LG hat für das G6 mit Google und Amazon verhandelt
  2. Instant Tethering Googles automatischer WLAN-Hotspot
  3. Tastaturhülle Canopy hält Magic Keyboard und iPad zum Arbeiten zusammen

Bundestagswahl 2017: Verschont uns mit Digitalisierungs-Blabla 4.0!
Bundestagswahl 2017
Verschont uns mit Digitalisierungs-Blabla 4.0!
  1. Bundestagswahlkampf 2017 Die große Angst vor dem Internet
  2. Hackerangriffe BSI will Wahlmanipulationen bekämpfen

  1. Re: Gefährlich, wenn sich Dein Auto plötzlich...

    nexusbs | 03:45

  2. ganz einfach

    nexusbs | 03:35

  3. Re: Na und?

    nachgefragt | 02:52

  4. Re: Schade, dass es keinen Kommunismus in China gibt

    Yash | 02:48

  5. Re: Rollenspiele sind out

    divStar | 02:01


  1. 18:19

  2. 17:28

  3. 17:07

  4. 16:55

  5. 16:49

  6. 16:15

  7. 15:52

  8. 15:29


  1. Themen
  2. A
  3. B
  4. C
  5. D
  6. E
  7. F
  8. G
  9. H
  10. I
  11. J
  12. K
  13. L
  14. M
  15. N
  16. O
  17. P
  18. Q
  19. R
  20. S
  21. T
  22. U
  23. V
  24. W
  25. X
  26. Y
  27. Z
  28. #
 
    •  / 
    Zum Artikel