Gene Life 2012: Auswertung und Hinweise für Lebensführung
Gene Life 2012: Auswertung und Hinweise für Lebensführung (Bild: Yahoo/Screenshot: Golem.de)

Wissenschaft Yahoo verkauft in Japan Gentests

Der Internetkonzern Yahoo steigt in Japan in das Geschäftsfeld Gesundheit ein: Das Unternehmen bietet zusammen mit einem Partner Gentests in dem asiatischen Land an.

Anzeige

Die Gentests für jedermann kommen voraussichtlich im Dezember in Japan auf den Markt. Mit ihrer Hilfe sollen die Käufer feststellen können, ob sie eine Disposition für bestimmte Krankheiten haben.

Die Käufer von Gene Life 2012 nehmen eine Speichelprobe und schicken sie an Genesis Healthcare, ein in Tokio ansässiges Unternehmen, das auf Gentests spezialisiert ist. Genesis Healthcare untersuche dann 68 Gene auf die Disposition von Krankheiten wie Diabetes, Schlaganfall oder Herzkrankheiten, berichtet die Tageszeitung Japan Times.

Auswertung und Hinweise

Die Nutzer erhalten von dem Unternehmen nach etwa zwei Monaten eine Auswertung des Tests. Außerdem werden Hinweise mitgeliefert, wie die Probanden ihr Leben so führen, dass sie das Risiko des Ausbruchs einer der Krankheiten verringern können.

Der Test soll rund 30.000 Yen, umgerechnet knapp 300 Euro, kosten. Yahoo will 300 Tests pro Monat absetzen. Der Konzern wird lediglich die Vermarktung übernehmen und mit den Gentests selbst nichts zu tun haben.


pholem 06. Nov 2012

Ahja, danke. http://www.heise.de/newsticker/meldung/Das-vermessene-Ich-Koerper-und...

attitudinized 03. Nov 2012

Also ich finde "Kunden mit Sequenz GATAAATCTGGTCTTTATTCC haben auch (...)gekauft." besser ;-)

Kommentieren



Anzeige

  1. Interaktionsdesigner/-in für Bedien- und Anzeigekonzepte
    Daimler AG, Sindelfingen
  2. IT-Koordinator/-in im Bereich Service Delivery für SAP ERP
    Daimler AG, Stuttgart
  3. SAP-Rollout-Berater/in Produktion
    Schaeffler Technologies AG & Co. KG, Herzogenaurach
  4. Senior Softwareentwickler - Medizingeräte (m/w)
    SORIN GROUP Deutschland GmbH, München

 

Detailsuche


Blu-ray-Angebote
  1. Filmfestival-Filme zum Sonderpreis
  2. Serien bis zu 40% reduziert
    (u. a. Downton Abbey 4. Staffel 19,97€, Eureka Season 5 nur 19,97€)
  3. 3D-Blu-rays bis zu 40% günstiger
    (u. a. Wacken der Film, El Gringo, Sharktopus, Unsere Erde, Street Dance)

 

Weitere Angebote


Folgen Sie uns
       


  1. Dota 2

    Wer wird neuer Dota-Millionär?

  2. Macbooks

    IBM wechselt vom Lenovo Thinkpad zum Mac

  3. Xperia M5 und C5 Ultra

    Sonys Angriff auf die Mittelklasse

  4. Virtual Reality

    Strategien gegen Übelkeit

  5. Juke

    Film-Streaming-Flatrate bei Media-Saturn künftig möglich

  6. Anonymisierung

    Weiterer Angriff auf das Tor-Netzwerk beschrieben

  7. Internet

    Unitymedia senkt die Preise

  8. TempleOS im Test

    Göttlicher Hardcore

  9. Ermittlungen gegen Netzpolitik.org

    Mehrere Ministerien wussten Bescheid

  10. Enlighten

    BMW erkennt Ampelphasen und zeigt Countdown an



Haben wir etwas übersehen?

E-Mail an news@golem.de



Kritik an Dieter Nuhr: Wir alle sind der Shitstorm
Kritik an Dieter Nuhr
Wir alle sind der Shitstorm

Visual Studio 2015 erschienen: Ganz viel für Apps und Open Source
Visual Studio 2015 erschienen
Ganz viel für Apps und Open Source

Meizu MX4 mit Ubuntu im Test: Knapp daneben ist wieder vorbei
Meizu MX4 mit Ubuntu im Test
Knapp daneben ist wieder vorbei
  1. Meizu MX4 Ubuntu-Smartphone kommt noch diese Woche nach Europa
  2. Canonical Ubuntu-Phone mit Konvergenz kommt im Oktober
  3. Mark Shuttleworth Canonical erwägt offenbar Börsengang

  1. Re: "bisher höchste Preisgeld der Dota-2-Geschichte"

    JP | 05:09

  2. Re: Erde an Windows-Lemminge (inkl. Golem)! Bitte...

    SoniX | 04:09

  3. Re: Hololens mit kleinem "Field of View"

    Stahlreck | 04:07

  4. Re: Linux ist der perfekte Nachfolger

    themario | 03:59

  5. Re: Hat jemand Tips zu Alternativen?

    Aslo | 03:07


  1. 19:36

  2. 19:03

  3. 17:30

  4. 17:00

  5. 15:41

  6. 13:59

  7. 12:59

  8. 12:01


  1. Themen
  2. A
  3. B
  4. C
  5. D
  6. E
  7. F
  8. G
  9. H
  10. I
  11. J
  12. K
  13. L
  14. M
  15. N
  16. O
  17. P
  18. Q
  19. R
  20. S
  21. T
  22. U
  23. V
  24. W
  25. X
  26. Y
  27. Z
  28. #
 
    •  / 
    Zum Artikel