Wissenschaft Yahoo verkauft in Japan Gentests

Der Internetkonzern Yahoo steigt in Japan in das Geschäftsfeld Gesundheit ein: Das Unternehmen bietet zusammen mit einem Partner Gentests in dem asiatischen Land an.

Anzeige

Die Gentests für jedermann kommen voraussichtlich im Dezember in Japan auf den Markt. Mit ihrer Hilfe sollen die Käufer feststellen können, ob sie eine Disposition für bestimmte Krankheiten haben.

Die Käufer von Gene Life 2012 nehmen eine Speichelprobe und schicken sie an Genesis Healthcare, ein in Tokio ansässiges Unternehmen, das auf Gentests spezialisiert ist. Genesis Healthcare untersuche dann 68 Gene auf die Disposition von Krankheiten wie Diabetes, Schlaganfall oder Herzkrankheiten, berichtet die Tageszeitung Japan Times.

Auswertung und Hinweise

Die Nutzer erhalten von dem Unternehmen nach etwa zwei Monaten eine Auswertung des Tests. Außerdem werden Hinweise mitgeliefert, wie die Probanden ihr Leben so führen, dass sie das Risiko des Ausbruchs einer der Krankheiten verringern können.

Der Test soll rund 30.000 Yen, umgerechnet knapp 300 Euro, kosten. Yahoo will 300 Tests pro Monat absetzen. Der Konzern wird lediglich die Vermarktung übernehmen und mit den Gentests selbst nichts zu tun haben.


pholem 06. Nov 2012

Ahja, danke. http://www.heise.de/newsticker/meldung/Das-vermessene-Ich-Koerper-und...

attitudinized 03. Nov 2012

Also ich finde "Kunden mit Sequenz GATAAATCTGGTCTTTATTCC haben auch (...)gekauft." besser ;-)

Kommentieren



Anzeige

  1. Mitarbeiter/-in Informationstechnologie, Produktdatenmanagement / Bill of Materials Support und Prozesse
    Daimler AG, Sindelfingen
  2. Oracle RightNow Administrator (m/w)
    Media-Saturn E-Business Concepts & Services GmbH, Ingolstadt
  3. IT-Projektleiter/in
    Landeshauptstadt München, München
  4. Softwareentwickler (m/w)
    SEW-EURODRIVE GmbH & Co KG, Bruchsal

 

Detailsuche


Folgen Sie uns
       


  1. F-Secure

    David Hasselhoff spricht auf der Re:publica in Berlin

  2. "Leicht zu verdauen"

    SAP bietet Ratenkauf und kündigt vereinfachte GUI an

  3. Test The Elder Scrolls Online

    Skyrim meets Standard-MMORPG

  4. AMD-Vize Lisa Su

    Geringe Chancen für 20-Nanometer-GPUs von AMD für 2014

  5. Bärbel Höhn

    Smartphone-Hersteller zu Diebstahl-Sperre zwingen

  6. Taxi-App

    Uber will trotz Verbot in weitere deutsche Städte

  7. First-Person-Walker

    Wie viel Gameplay braucht ein Spiel?

  8. Finanzierungsrunde

    Startup Airbnb ist zehn Milliarden US-Dollar wert

  9. Spähaffäre

    Snowden erklärt seine Frage an Putin

  10. CSA-Verträge

    Microsoft senkt Preise für Support von Windows XP



Haben wir etwas übersehen?

E-Mail an news@golem.de


Anzeige
IMHO - Heartbleed und die Folgen: TLS entrümpeln
IMHO - Heartbleed und die Folgen
TLS entrümpeln

Die Spezifikation der TLS-Verschlüsselung ist ein Gemischtwarenladen aus exotischen Algorithmen und nie benötigten Erweiterungen. Es ist Zeit für eine große Entrümpelungsaktion.

  1. Bleichenbacher-Angriff TLS-Probleme in Java
  2. Revocation Zurückziehen von Zertifikaten bringt wenig
  3. TLS-Bibliotheken Fehler finden mit fehlerhaften Zertifikaten

Owncloud: Dropbox-Alternative fürs Heimnetzwerk
Owncloud
Dropbox-Alternative fürs Heimnetzwerk

Kaputte Zertifikate durch Heartbleed und der NSA-Skandal: Es gibt genügend Gründe, seinen eigenen Cloud-Speicher einzurichten. Wir erklären mit Owncloud auf einem Raspberry Pi, wie das funktioniert.


Test LG L40: Android 4.4.2 macht müde Smartphones munter
Test LG L40
Android 4.4.2 macht müde Smartphones munter

Mit dem L40 präsentiert LG eines der ersten Smartphones mit der aktuellen Android-Version 4.4.2, das unter 100 Euro kostet. Dank der Optimierungen von Kitkat überrascht die Leistung des kleinen Gerätes - und es dürfte nicht nur für Einsteiger interessant sein.

  1. LG G3 5,5-Zoll-Smartphone mit 1440p-Display und Kitkat
  2. LG L35 Smartphone mit Android 4.4 für 80 Euro
  3. Programmierbare LED-Lampe LG kündigt Alternative zur Philips Hue an

    •  / 
    Zum Artikel