Anzeige
Gene Life 2012: Auswertung und Hinweise für Lebensführung
Gene Life 2012: Auswertung und Hinweise für Lebensführung (Bild: Yahoo/Screenshot: Golem.de)

Wissenschaft: Yahoo verkauft in Japan Gentests

Gene Life 2012: Auswertung und Hinweise für Lebensführung
Gene Life 2012: Auswertung und Hinweise für Lebensführung (Bild: Yahoo/Screenshot: Golem.de)

Der Internetkonzern Yahoo steigt in Japan in das Geschäftsfeld Gesundheit ein: Das Unternehmen bietet zusammen mit einem Partner Gentests in dem asiatischen Land an.

Die Gentests für jedermann kommen voraussichtlich im Dezember in Japan auf den Markt. Mit ihrer Hilfe sollen die Käufer feststellen können, ob sie eine Disposition für bestimmte Krankheiten haben.

Die Käufer von Gene Life 2012 nehmen eine Speichelprobe und schicken sie an Genesis Healthcare, ein in Tokio ansässiges Unternehmen, das auf Gentests spezialisiert ist. Genesis Healthcare untersuche dann 68 Gene auf die Disposition von Krankheiten wie Diabetes, Schlaganfall oder Herzkrankheiten, berichtet die Tageszeitung Japan Times.

Anzeige

Auswertung und Hinweise

Die Nutzer erhalten von dem Unternehmen nach etwa zwei Monaten eine Auswertung des Tests. Außerdem werden Hinweise mitgeliefert, wie die Probanden ihr Leben so führen, dass sie das Risiko des Ausbruchs einer der Krankheiten verringern können.

Der Test soll rund 30.000 Yen, umgerechnet knapp 300 Euro, kosten. Yahoo will 300 Tests pro Monat absetzen. Der Konzern wird lediglich die Vermarktung übernehmen und mit den Gentests selbst nichts zu tun haben.


eye home zur Startseite
pholem 06. Nov 2012

Ahja, danke. http://www.heise.de/newsticker/meldung/Das-vermessene-Ich-Koerper-und...

attitudinized 03. Nov 2012

Also ich finde "Kunden mit Sequenz GATAAATCTGGTCTTTATTCC haben auch (...)gekauft." besser ;-)

Kommentieren



Anzeige

  1. Professional User Experience Design Services (m/w)
    Deutsche Telekom Kundenservice GmbH, Bonn
  2. Systemberater/in EAI Plattformen
    Robert Bosch GmbH, Stuttgart
  3. Frontend-Entwickler (m/w) E-Commerce
    LIDL Stiftung & Co. KG, Neckarsulm oder Berlin
  4. Dependency Manager Releases (m/w)
    T-Systems International GmbH, Bonn

Detailsuche



Anzeige
Blu-ray-Angebote
  1. 3 Blu-rays für 20 EUR
    (u. a. Die Maske, Die Goonies, Kiss Kiss Bang Bang, Batman: Under the Red Hood)
  2. VORBESTELLBAR: BÖHSE FÜR'S LEBEN [Blu-ray]
    36,99€
  3. VORBESTELLBAR: Ultimate Collector’s Edition Harry Potter – inkl. Steelbooks und Sammlerstücke (exklusiv bei Amazon.de) [Blu-ray] [
    149,99€

Weitere Angebote


Folgen Sie uns
       


  1. Axanar

    Paramount/CBS erlaubt Star-Trek-Fanfilme

  2. FTTH/FTTB

    Oberirdische Glasfaser spart 85 Prozent der Kosten

  3. Botnet

    Necurs kommt zurück und bringt Locky millionenfach mit

  4. Google

    Livestreaming direkt aus der Youtube-App

  5. Autonome Autos

    Fahrer wollen vor allem ihr eigenes Leben schützen

  6. Boston Dynamics

    Spot Mini, die Roboraffe

  7. Datenrate

    Tele Columbus versorgt fast 840.000 Haushalte mit 400 MBit/s

  8. Supercomputer

    China und Japan setzen auf ARM-Kerne für kommende Systeme

  9. Patent

    Die springenden Icons von Apple

  10. Counter-Strike

    Klage gegen Wetten mit Waffen-Skins



Haben wir etwas übersehen?

E-Mail an news@golem.de


Anzeige
Oneplus Three im Test: Ein Alptraum für die Android-Konkurrenz
Oneplus Three im Test
Ein Alptraum für die Android-Konkurrenz
  1. Android-Smartphone Diskussionen um Speichermanagement beim Oneplus Three
  2. Smartphones Oneplus soll keine günstigeren Modellreihen mehr planen
  3. Ohne Einladung Oneplus Three kommt mit 6 GByte RAM für 400 Euro

Zelda Breath of the Wild angespielt: Das Versprechen von 1986 wird eingelöst
Zelda Breath of the Wild angespielt
Das Versprechen von 1986 wird eingelöst

Vorratsdatenspeicherung: Vorgaben übertreffen laut Eco "schlimmste Befürchtungen"
Vorratsdatenspeicherung
Vorgaben übertreffen laut Eco "schlimmste Befürchtungen"
  1. Vorratsdatenspeicherung Alarm im VDS-Tresor
  2. Neue Snowden-Dokumente NSA lobte Deutschlands "wesentliche" Hilfe im Irak-Krieg
  3. Klage Verwaltungsgericht soll Vorratsdatenspeicherung stoppen

  1. Re: Einfach nicht Star Trek nennen

    Moe479 | 05:15

  2. Re: Ist doch korrekt

    M.Kessel | 02:45

  3. Re: Okay, morgen gehts los, 2019 sind wir fertig...

    jacki | 02:44

  4. Re: nein Danke

    M.Kessel | 02:32

  5. Re: Whitelisting ist nicht verboten

    M.Kessel | 02:25


  1. 17:47

  2. 17:01

  3. 16:46

  4. 15:51

  5. 15:48

  6. 15:40

  7. 14:58

  8. 14:31


  1. Themen
  2. A
  3. B
  4. C
  5. D
  6. E
  7. F
  8. G
  9. H
  10. I
  11. J
  12. K
  13. L
  14. M
  15. N
  16. O
  17. P
  18. Q
  19. R
  20. S
  21. T
  22. U
  23. V
  24. W
  25. X
  26. Y
  27. Z
  28. #
 
    •  / 
    Zum Artikel