Gene Life 2012: Auswertung und Hinweise für Lebensführung
Gene Life 2012: Auswertung und Hinweise für Lebensführung (Bild: Yahoo/Screenshot: Golem.de)

Wissenschaft Yahoo verkauft in Japan Gentests

Der Internetkonzern Yahoo steigt in Japan in das Geschäftsfeld Gesundheit ein: Das Unternehmen bietet zusammen mit einem Partner Gentests in dem asiatischen Land an.

Anzeige

Die Gentests für jedermann kommen voraussichtlich im Dezember in Japan auf den Markt. Mit ihrer Hilfe sollen die Käufer feststellen können, ob sie eine Disposition für bestimmte Krankheiten haben.

Die Käufer von Gene Life 2012 nehmen eine Speichelprobe und schicken sie an Genesis Healthcare, ein in Tokio ansässiges Unternehmen, das auf Gentests spezialisiert ist. Genesis Healthcare untersuche dann 68 Gene auf die Disposition von Krankheiten wie Diabetes, Schlaganfall oder Herzkrankheiten, berichtet die Tageszeitung Japan Times.

Auswertung und Hinweise

Die Nutzer erhalten von dem Unternehmen nach etwa zwei Monaten eine Auswertung des Tests. Außerdem werden Hinweise mitgeliefert, wie die Probanden ihr Leben so führen, dass sie das Risiko des Ausbruchs einer der Krankheiten verringern können.

Der Test soll rund 30.000 Yen, umgerechnet knapp 300 Euro, kosten. Yahoo will 300 Tests pro Monat absetzen. Der Konzern wird lediglich die Vermarktung übernehmen und mit den Gentests selbst nichts zu tun haben.


pholem 06. Nov 2012

Ahja, danke. http://www.heise.de/newsticker/meldung/Das-vermessene-Ich-Koerper-und...

attitudinized 03. Nov 2012

Also ich finde "Kunden mit Sequenz GATAAATCTGGTCTTTATTCC haben auch (...)gekauft." besser ;-)

Kommentieren



Anzeige

  1. C++/Qt Frontend Developer (m/w)
    über Dr. Pendl & Dr. Piswanger, Vomp (Österreich)
  2. Senior Project Manager Solutions & Databases, Google EMEA (m/w)
    Schober Information Group Deutschland GmbH, Stuttgart / London (Großbritannien)
  3. System- und Basisadministrator (m/w)
    RheinEnergie AG, Köln
  4. Projekt- / Service-Ingenieur HMI / SCADA / Prozessleittechnik (m/w)
    SCHOTT AG, Mainz

 

Detailsuche


Spiele-Angebote
  1. Hunted: Die Schmiede der Finsternis [Online Code]
    5,97€ USK 18
  2. Call of Cthulhu - Dark Corners of the Earth Download
    5,97€ USK 18
  3. Homeworld Remastered Collection - [PC]
    29,99€ (Release 7.5.)

 

Weitere Angebote


Folgen Sie uns
       


  1. Amtsgericht Hamburg

    Online-Partnervermittlungen dürfen kein Geld nehmen

  2. Elite Dangerous

    Powerplay im All

  3. Martin Gräßlin

    KDE Plasma läuft erstmals unter Wayland

  4. Canonical

    Ubuntus Desktop-Next soll auf DEB-Pakete verzichten

  5. Glasschair

    Mit der Google Glass den Rollstuhl steuern

  6. Günther Oettinger

    EU und Telekom wollen Regulierung zu Whatsapp und Google

  7. Ebay

    Magento-Shops stehen Angreifern offen

  8. Acer Iconia One 8

    Kleines Android-Tablet mit Intels Quadcore-Atom

  9. Markenrecht

    Band Kraftwerk unterliegt Brennstoffzellenkraftwerk

  10. Teut Weidemann

    Die Tricks der Free-to-Play-Betreiber



Haben wir etwas übersehen?

E-Mail an news@golem.de



The Ocean Cleanup: Ein Müllfänger für die Meere
The Ocean Cleanup
Ein Müllfänger für die Meere
  1. Vorbild Tintenfisch Tarnmaterial ändert seine Farbe
  2. Keine Science-Fiction Mit dem Laser gegen Weltraumschrott
  3. Maglev Magnetschwebebahn erreicht in Japan 590 km/h

GTA 5 im Technik-Test: So sieht eine famose PC-Umsetzung aus
GTA 5 im Technik-Test
So sieht eine famose PC-Umsetzung aus
  1. GTA 5 auf dem PC Erst beschränkter Zugriff, dann mehr Freiheit
  2. GTA 5 PC Rockstar Games gibt Systemanforderungen für Ultra-HD bekannt
  3. GTA 5 PC angespielt Los Santos ohne Staubschleier

Hello Firefox OS: Einfacher Einstieg in die App-Entwicklung mit Firefox OS
Hello Firefox OS
Einfacher Einstieg in die App-Entwicklung mit Firefox OS
  1. Biicode Abhängigkeitsverwaltung für C/C++ ist Open Source
  2. Freie Bürosoftware Libreoffice liegt im Rennen gegen Openoffice weit vorne
  3. ARM-SoC Allwinner verschleiert Lizenzverletzungen noch weiter

  1. Re: Hoffentlich setzt sich dieses Urteil bei...

    Madricks | 05:42

  2. Re: Fehlererklärung

    Moe479 | 04:51

  3. Re: Antwort: Alles ausser neuere Spiele, die...

    Tzven | 04:40

  4. Re: 1915 & 2015

    Tzven | 04:22

  5. Re: Hört hört....

    Aslo | 04:17


  1. 18:41

  2. 16:27

  3. 16:04

  4. 15:06

  5. 14:42

  6. 14:09

  7. 13:27

  8. 13:02


  1. Themen
  2. A
  3. B
  4. C
  5. D
  6. E
  7. F
  8. G
  9. H
  10. I
  11. J
  12. K
  13. L
  14. M
  15. N
  16. O
  17. P
  18. Q
  19. R
  20. S
  21. T
  22. U
  23. V
  24. W
  25. X
  26. Y
  27. Z
  28. #
 
    •  / 
    Zum Artikel