Wissenschaft Yahoo verkauft in Japan Gentests

Der Internetkonzern Yahoo steigt in Japan in das Geschäftsfeld Gesundheit ein: Das Unternehmen bietet zusammen mit einem Partner Gentests in dem asiatischen Land an.


Die Gentests für jedermann kommen voraussichtlich im Dezember in Japan auf den Markt. Mit ihrer Hilfe sollen die Käufer feststellen können, ob sie eine Disposition für bestimmte Krankheiten haben.

Die Käufer von Gene Life 2012 nehmen eine Speichelprobe und schicken sie an Genesis Healthcare, ein in Tokio ansässiges Unternehmen, das auf Gentests spezialisiert ist. Genesis Healthcare untersuche dann 68 Gene auf die Disposition von Krankheiten wie Diabetes, Schlaganfall oder Herzkrankheiten, berichtet die Tageszeitung Japan Times.

Auswertung und Hinweise

Die Nutzer erhalten von dem Unternehmen nach etwa zwei Monaten eine Auswertung des Tests. Außerdem werden Hinweise mitgeliefert, wie die Probanden ihr Leben so führen, dass sie das Risiko des Ausbruchs einer der Krankheiten verringern können.

Der Test soll rund 30.000 Yen, umgerechnet knapp 300 Euro, kosten. Yahoo will 300 Tests pro Monat absetzen. Der Konzern wird lediglich die Vermarktung übernehmen und mit den Gentests selbst nichts zu tun haben.

pholem 06. Nov 2012

Ahja, danke. http://www.heise.de/newsticker/meldung/Das-vermessene-Ich-Koerper-und...

attitudinized 03. Nov 2012

Also ich finde "Kunden mit Sequenz GATAAATCTGGTCTTTATTCC haben auch (...)gekauft." besser ;-)



  1. Entwic­kler Con­trol­ling­sys­teme (m/w)
    Bitburger Braugruppe GmbH, Bitburg
  2. Leiter/in des Universitätsrechenzentrums
    Katholische Universität Eichstätt-Ingolstadt, Eichstätt-Ingolstadt
  3. SPS-Programmierer Steuerungen / Automatisierungslösungen (m/w)
    über CAPERA Consulting, Nordhessen
  4. IT-Projektmanager (m/w) Systemgestaltung im Arbeitsgebiet Fahrzeugeinplanung / Programmplanung
    Daimler AG, Sindelfingen



Folgen Sie uns

  1. Quartalsbericht

    Facebook macht erneut Rekordgewinn

  2. Quartalszahlen

    Apple kann Gewinn und Umsatz wieder steigern

  3. IBM Power8

    Mit 96 Threads pro Sockel gegen Intels Übermacht

  4. Printoo

    Arduino kannste jetzt knicken

  5. Cloud-Dienste

    Streem verspricht unbegrenzten Speicherplatz

  6. Streaming

    HBO-Serien für US-Kunden von Amazon Prime

  7. Theo de Raadt

    OpenSSL ist nicht reparierbar

  8. Xplore XC6 DMSR

    Blendend hell und hart im Nehmen

  9. Programmiersprache

    Go 1.3 kommt für Solaris, Plan 9 und NaCL

  10. Arin

    IPv4-Adressen in Nordamerika nähern sich dem Ende

Haben wir etwas übersehen?

E-Mail an news@golem.de

Test LG L40: Android 4.4.2 macht müde Smartphones munter
Test LG L40
Android 4.4.2 macht müde Smartphones munter

Mit dem L40 präsentiert LG eines der ersten Smartphones mit der aktuellen Android-Version 4.4.2, das unter 100 Euro kostet. Dank der Optimierungen von Kitkat überrascht die Leistung des kleinen Gerätes - und es dürfte nicht nur für Einsteiger interessant sein.

  1. LG G3 5,5-Zoll-Smartphone mit 1440p-Display und Kitkat
  2. LG L35 Smartphone mit Android 4.4 für 80 Euro
  3. Programmierbare LED-Lampe LG kündigt Alternative zur Philips Hue an

Scaler: Xbox, streck das Bild!
Xbox, streck das Bild!

Die Xbox One berechnet viele Spiele nicht nativ in 1080p. Stattdessen vergrößern ein Hardware-Scaler oder einige Softwareschritte niedrigere Auflösungen. Beide Lösungen bieten Vor- und Nachteile, welche die Bildqualität oder Bildrate beeinflussen.

  1. Microsoft Xbox One wagt sich im September 2014 nach Japan
  2. Konsolen Microsoft meldet fünf Millionen Xbox One
  3. Xbox One Upgedated und preisgesenkt

Nokia X mit Android im Test: Windows Phone in Schlecht
Nokia X mit Android im Test
Windows Phone in Schlecht

Nokia hat also doch noch ein Android-Smartphone auf den Markt gebracht: Das Nokia X hat eine stark angepasste Oberfläche, die an Windows Phone 8 erinnert, aber deutlich weniger gut läuft. Was genau Nokia mit dem X erreichen will, ist schwer auszumachen.

  1. Smartphones Diese Woche geht Nokias Mobiltelefonsparte an Microsoft
  2. Android ohne Google Nokia X bei Händlern in Deutschland verfügbar
  3. Nokia 225 Handy mit über einem Monat Akkulaufzeit für 50 Euro

    •  / 
    Zum Artikel