Wissenschaft: Yahoo verkauft in Japan Gentests
Gene Life 2012: Auswertung und Hinweise für Lebensführung (Bild: Yahoo/Screenshot: Golem.de)

Wissenschaft Yahoo verkauft in Japan Gentests

Der Internetkonzern Yahoo steigt in Japan in das Geschäftsfeld Gesundheit ein: Das Unternehmen bietet zusammen mit einem Partner Gentests in dem asiatischen Land an.

Anzeige

Die Gentests für jedermann kommen voraussichtlich im Dezember in Japan auf den Markt. Mit ihrer Hilfe sollen die Käufer feststellen können, ob sie eine Disposition für bestimmte Krankheiten haben.

Die Käufer von Gene Life 2012 nehmen eine Speichelprobe und schicken sie an Genesis Healthcare, ein in Tokio ansässiges Unternehmen, das auf Gentests spezialisiert ist. Genesis Healthcare untersuche dann 68 Gene auf die Disposition von Krankheiten wie Diabetes, Schlaganfall oder Herzkrankheiten, berichtet die Tageszeitung Japan Times.

Auswertung und Hinweise

Die Nutzer erhalten von dem Unternehmen nach etwa zwei Monaten eine Auswertung des Tests. Außerdem werden Hinweise mitgeliefert, wie die Probanden ihr Leben so führen, dass sie das Risiko des Ausbruchs einer der Krankheiten verringern können.

Der Test soll rund 30.000 Yen, umgerechnet knapp 300 Euro, kosten. Yahoo will 300 Tests pro Monat absetzen. Der Konzern wird lediglich die Vermarktung übernehmen und mit den Gentests selbst nichts zu tun haben.


pholem 06. Nov 2012

Ahja, danke. http://www.heise.de/newsticker/meldung/Das-vermessene-Ich-Koerper-und...

attitudinized 03. Nov 2012

Also ich finde "Kunden mit Sequenz GATAAATCTGGTCTTTATTCC haben auch (...)gekauft." besser ;-)

Kommentieren



Anzeige

  1. Senior Software Engineer (m/w) ASP.NET und SharePoint
    adesso AG, verschiedene Standorte
  2. SharePoint Inhouse Consultant (m/w)
    BEUMER Group GmbH & Co. KG, Beckum (Raum Münster, Dortmund, Bielefeld)
  3. JAVA Softwareentwickler (m/w)
    MPDV Mikrolab GmbH, Heimsheim
  4. IT-Teamleitungen (m/w) für Betreute Lokale Netze an beruflichen Schulen
    Landeshauptstadt München, München

 

Detailsuche


Folgen Sie uns
       


  1. Deutsche Grammophon

    Klassik streamen mit bis zu 320 Kbps

  2. Alibaba

    Milliardenschwerer Börsengang wohl Mitte September

  3. Test Infamous First Light

    Neonbunter Actionspaß

  4. Nach Wurstfirmeninsolvenz

    Redtube-Abmahn-Anwalt verliert Zulassung

  5. Gat out of Hell

    Saints Row und die Froschplage in der Hölle

  6. Ridesharing

    Taxidienst Uber in 200 Städten verfügbar

  7. Telefónica und E-Plus

    "Haben endgültige Freigabe von EU-Kommission bekommen"

  8. Intel Core i7-5960X im Test

    Die PC-Revolution beginnt mit Octacore und DDR4

  9. Nintendo

    Neuer 3DS mit NFC und zweitem Analogstick

  10. Onlinereiseplattform

    Opodo darf Nutzern keine Versicherungen unterschieben



Haben wir etwas übersehen?

E-Mail an news@golem.de



Überschall-U-Boot: Von Schanghai nach San Francisco in 100 Minuten
Überschall-U-Boot
Von Schanghai nach San Francisco in 100 Minuten

Qnap QGenie im Test: Netzwerkspeicher fehlt's an Speicher
Qnap QGenie im Test
Netzwerkspeicher fehlt's an Speicher
  1. Qnap QGenie NAS-System für die Hosentasche
  2. HS-251 Qnap beschleunigt lüfterloses NAS-System
  3. QNAP TS-EC1080 Pro Erweiterbares NAS-System im Tower mit mSATA-Plätzen

Kinkobox angeschaut: E-Mail-Verschlüsselung leicht gemacht
Kinkobox angeschaut
E-Mail-Verschlüsselung leicht gemacht
  1. IT-Sicherheitsgesetz Telekomfirmen müssen Nutzer über Cyberangriffe informieren
  2. IT-Sicherheitsgesetz Unternehmen dürfen ungefährliche Angriffe anonym melden
  3. Cryptophone Telekom mit Ende-zu-Ende-Verschlüsselung für Smartphones

    •  / 
    Zum Artikel