Wissenschaft: Yahoo verkauft in Japan Gentests
Gene Life 2012: Auswertung und Hinweise für Lebensführung (Bild: Yahoo/Screenshot: Golem.de)

Wissenschaft Yahoo verkauft in Japan Gentests

Der Internetkonzern Yahoo steigt in Japan in das Geschäftsfeld Gesundheit ein: Das Unternehmen bietet zusammen mit einem Partner Gentests in dem asiatischen Land an.

Anzeige

Die Gentests für jedermann kommen voraussichtlich im Dezember in Japan auf den Markt. Mit ihrer Hilfe sollen die Käufer feststellen können, ob sie eine Disposition für bestimmte Krankheiten haben.

Die Käufer von Gene Life 2012 nehmen eine Speichelprobe und schicken sie an Genesis Healthcare, ein in Tokio ansässiges Unternehmen, das auf Gentests spezialisiert ist. Genesis Healthcare untersuche dann 68 Gene auf die Disposition von Krankheiten wie Diabetes, Schlaganfall oder Herzkrankheiten, berichtet die Tageszeitung Japan Times.

Auswertung und Hinweise

Die Nutzer erhalten von dem Unternehmen nach etwa zwei Monaten eine Auswertung des Tests. Außerdem werden Hinweise mitgeliefert, wie die Probanden ihr Leben so führen, dass sie das Risiko des Ausbruchs einer der Krankheiten verringern können.

Der Test soll rund 30.000 Yen, umgerechnet knapp 300 Euro, kosten. Yahoo will 300 Tests pro Monat absetzen. Der Konzern wird lediglich die Vermarktung übernehmen und mit den Gentests selbst nichts zu tun haben.


pholem 06. Nov 2012

Ahja, danke. http://www.heise.de/newsticker/meldung/Das-vermessene-Ich-Koerper-und...

attitudinized 03. Nov 2012

Also ich finde "Kunden mit Sequenz GATAAATCTGGTCTTTATTCC haben auch (...)gekauft." besser ;-)

Kommentieren



Anzeige

  1. Consultant / Projektmanager (m/w) im Geo-IT-Umfeld
    con terra GmbH, Münster
  2. Produktmanager (m/w) für "Analyzer System Manager (ASM)"
    Siemens AG, Karlsruhe
  3. Software-System-Architekt & -Entwickler (m/w) für komplexe Server-Lösungen
    CeTEC GmbH & Co KG, Oberhaching (München-Süd) oder Rosenheim (Oberbayern)
  4. Softwareentwickler/-in
    NOWEDA, Essen

 

Detailsuche


Folgen Sie uns
       


  1. Pelican

    Erste Bilder der Insektenaugen-Kamera

  2. Odroid W

    Raspberry Pi-Klon für Fortgeschrittene

  3. Hohe Kosten

    Amazon kostet jedes Fire Phone 205 US-Dollar

  4. iPhone-App

    Sicherheitslücke bei Instagram

  5. Oculus Rift

    Development Kit 2 ist da

  6. Android

    Zertifikatskette wird nicht geprüft

  7. Spielemesse

    Gamescom fast ausverkauft

  8. Secusmart

    Blackberry übernimmt Merkel-Handy-Hersteller

  9. NSA-Affäre

    Bundesjustizminister wegen Empfehlung an Snowden kritisiert

  10. Playstation 4

    Firmware-Update ermöglicht 3D-Blu-ray



Haben wir etwas übersehen?

E-Mail an news@golem.de


Anzeige
Liebessimulation Love Plus: "Ich hoffe, du wirst für immer schön bleiben"
Liebessimulation Love Plus
"Ich hoffe, du wirst für immer schön bleiben"
  1. PES 2015 angespielt Neuer Ball auf frischem Rasen
  2. Metal Gear Solid - The Phantom Pain Krabbelnde Kisten und schwebende Schafe

LG 34UM95 im Test: Ultra-Widescreen-Monitor für 3K-Gaming
LG 34UM95 im Test
Ultra-Widescreen-Monitor für 3K-Gaming
  1. Free-Form Display Sharp zeigt LCD mit kurvigem Rahmen
  2. Eizo Foris FS2434 IPS-Display mit schmalem Rahmen für Spieler
  3. Philips 19DP6QJNS Klappmonitor mit zwei IPS-Displays

Bluetooth Low Energy und Websockets: Raspberry Pi als Schaltzentrale fürs Haus
Bluetooth Low Energy und Websockets
Raspberry Pi als Schaltzentrale fürs Haus
  1. Echtzeitkommunikation Socket.io 1.0 mit neuer Engine

    •  / 
    Zum Artikel