Gene Life 2012: Auswertung und Hinweise für Lebensführung
Gene Life 2012: Auswertung und Hinweise für Lebensführung (Bild: Yahoo/Screenshot: Golem.de)

Wissenschaft Yahoo verkauft in Japan Gentests

Der Internetkonzern Yahoo steigt in Japan in das Geschäftsfeld Gesundheit ein: Das Unternehmen bietet zusammen mit einem Partner Gentests in dem asiatischen Land an.

Anzeige

Die Gentests für jedermann kommen voraussichtlich im Dezember in Japan auf den Markt. Mit ihrer Hilfe sollen die Käufer feststellen können, ob sie eine Disposition für bestimmte Krankheiten haben.

Die Käufer von Gene Life 2012 nehmen eine Speichelprobe und schicken sie an Genesis Healthcare, ein in Tokio ansässiges Unternehmen, das auf Gentests spezialisiert ist. Genesis Healthcare untersuche dann 68 Gene auf die Disposition von Krankheiten wie Diabetes, Schlaganfall oder Herzkrankheiten, berichtet die Tageszeitung Japan Times.

Auswertung und Hinweise

Die Nutzer erhalten von dem Unternehmen nach etwa zwei Monaten eine Auswertung des Tests. Außerdem werden Hinweise mitgeliefert, wie die Probanden ihr Leben so führen, dass sie das Risiko des Ausbruchs einer der Krankheiten verringern können.

Der Test soll rund 30.000 Yen, umgerechnet knapp 300 Euro, kosten. Yahoo will 300 Tests pro Monat absetzen. Der Konzern wird lediglich die Vermarktung übernehmen und mit den Gentests selbst nichts zu tun haben.


pholem 06. Nov 2012

Ahja, danke. http://www.heise.de/newsticker/meldung/Das-vermessene-Ich-Koerper-und...

attitudinized 03. Nov 2012

Also ich finde "Kunden mit Sequenz GATAAATCTGGTCTTTATTCC haben auch (...)gekauft." besser ;-)

Kommentieren



Anzeige

  1. Funktions-/SW-Entwickler (m/w) konventionelle / alternative Antriebe
    Robert Bosch GmbH, Schwieberdingen
  2. Datenbank- / Anwendungsentwickler (m/w)
    MULTIVAC Sepp Haggenmüller GmbH & Co. KG, Wolfertschwenden
  3. Webdesigner / -entwickler (m/w)
    PROJECT PI Immobilien AG, Nürnberg
  4. Engineer (m/w) für Software / Hardware im Bereich Gebäudeautomation
    Siemens AG, Stuttgart

 

Detailsuche


Top-Angebote
  1. TIPP: Ryse: Son of Rome (PC Steam Code)
    15,97€ USK 18
  2. Transcend 1.000-GB-SSD
    329,99€

 

Weitere Angebote


Folgen Sie uns
       


  1. Spionagesoftware

    NSA-Programm Regin zwei Jahre im Kanzleramt aktiv

  2. Biofabrikation

    Forscher wollen Gewebe aus Spinnenseide drucken

  3. Ultrabook-Prozessor

    Intels Skylake ersetzt Broadwell bereits im Frühsommer

  4. GTX-970-Affäre

    AMD veralbert Nvidia per Twitter und verlost Grafikkarten

  5. Spielebranche

    Sega streicht 300 Stellen

  6. Gegen Pegida

    Informatiker und Bitkom für Flüchtlinge und Vielfalt

  7. Smartphones

    Huawei empfindet Windows Phone als Einheitsbrei

  8. FCC

    Erst 25 MBit/s sind in den USA jetzt ein Breitbandanschluss

  9. DVB-T2/HEVC

    Nur ein Betreiber will Antennen-TV in HD aufbauen

  10. Place Tips

    Facebook wird zum Stadtführer



Haben wir etwas übersehen?

E-Mail an news@golem.de



Testplattform für Grafikkarten: Des Golems Zauberwürfel
Testplattform für Grafikkarten
Des Golems Zauberwürfel
  1. Maxwell-Grafikkarte Nvidia korrigiert die Spezifikationen der Geforce GTX 970
  2. Geforce GTX 960 Nvidias neue Grafikkarte ist eine halbe GTX 980
  3. Bis 4 GHz Takt Samsung verdoppelt Grafikspeicher-Kapazität

Grim Fandango im Test: Neues Leben für untotes Abenteuer
Grim Fandango im Test
Neues Leben für untotes Abenteuer
  1. Vorschau 2015 Von Hexern, Fledermausmännern und VR-Brillen
  2. Spielejahr 2014 Gronkh, GTA 5 und #Gamergate
  3. Day of the Tentacle (1993) Zurück in die Zukunft, Vergangenheit und Gegenwart

Fehlender Cache verursacht Ruckler: Nvidias beschnittene Geforce GTX 970 stottert messbar
Fehlender Cache verursacht Ruckler
Nvidias beschnittene Geforce GTX 970 stottert messbar
  1. King Of The Hill AMDs 300-Watt-Grafikkarte nutzt High Bandwidth Memory
  2. Partikelsimulation Nvidias Flex rührt das Müsli an
  3. Grafiktreiber im Test AMD wagt mit Catalyst Omega Neuanfang samt Downsampling

    •  / 
    Zum Artikel