Wissenschaft: Yahoo verkauft in Japan Gentests
Gene Life 2012: Auswertung und Hinweise für Lebensführung (Bild: Yahoo/Screenshot: Golem.de)

Wissenschaft Yahoo verkauft in Japan Gentests

Der Internetkonzern Yahoo steigt in Japan in das Geschäftsfeld Gesundheit ein: Das Unternehmen bietet zusammen mit einem Partner Gentests in dem asiatischen Land an.

Anzeige

Die Gentests für jedermann kommen voraussichtlich im Dezember in Japan auf den Markt. Mit ihrer Hilfe sollen die Käufer feststellen können, ob sie eine Disposition für bestimmte Krankheiten haben.

Die Käufer von Gene Life 2012 nehmen eine Speichelprobe und schicken sie an Genesis Healthcare, ein in Tokio ansässiges Unternehmen, das auf Gentests spezialisiert ist. Genesis Healthcare untersuche dann 68 Gene auf die Disposition von Krankheiten wie Diabetes, Schlaganfall oder Herzkrankheiten, berichtet die Tageszeitung Japan Times.

Auswertung und Hinweise

Die Nutzer erhalten von dem Unternehmen nach etwa zwei Monaten eine Auswertung des Tests. Außerdem werden Hinweise mitgeliefert, wie die Probanden ihr Leben so führen, dass sie das Risiko des Ausbruchs einer der Krankheiten verringern können.

Der Test soll rund 30.000 Yen, umgerechnet knapp 300 Euro, kosten. Yahoo will 300 Tests pro Monat absetzen. Der Konzern wird lediglich die Vermarktung übernehmen und mit den Gentests selbst nichts zu tun haben.


pholem 06. Nov 2012

Ahja, danke. http://www.heise.de/newsticker/meldung/Das-vermessene-Ich-Koerper-und...

attitudinized 03. Nov 2012

Also ich finde "Kunden mit Sequenz GATAAATCTGGTCTTTATTCC haben auch (...)gekauft." besser ;-)

Kommentieren



Anzeige

  1. Software-Entwickler Java / JavaScript (m/w)
    TONBELLER AG, Bensheim
  2. Abteilungsleiter/in
    Robert Bosch GmbH, Renningen
  3. Java Entwickler/in
    Robert Bosch Car Multimedia GmbH, Hildesheim
  4. Systemadministrator (m/w) Windows
    KDO Personaldienste, Oldenburg

 

Detailsuche


Folgen Sie uns
       


  1. Nocomentator

    Filterkiste blendet Sportkommentare aus

  2. Gameworks

    Nvidia rollt den Rasen aus

  3. Rolling-Release

    Opensuse Factory und Tumbleweed werden zusammengeführt

  4. Project Ara

    Google will nicht nur das Smartphone neu erfinden

  5. Wildstar

    NC Soft entlässt Mitarbeiter

  6. Mozilla

    Einfache Web-Apps auf dem Smartphone erstellen

  7. Civ Beyond Earth Benchmark

    Schneller, ohne Mikroruckler und geringere Latenz mit Mantle

  8. Allview X2 Soul mini

    Sehr dünnes Smartphone im Alu-Gehäuse für 200 Euro

  9. Toybox Turbos

    Codemasters veranstaltet Rennen auf dem Frühstückstisch

  10. Xamarin

    C# dank Mono für die Unreal Engine 4



Haben wir etwas übersehen?

E-Mail an news@golem.de



Sony Alpha 7S im Test: Vollformater sieht auch bei Dunkelheit nicht schwarz
Sony Alpha 7S im Test
Vollformater sieht auch bei Dunkelheit nicht schwarz
  1. FPS 1000 Kamera soll 18.500 Frames pro Sekunde aufnehmen
  2. Bericht Sony will 4K-Superzoom-Kamera entwickeln
  3. Minikamera Ai-Ball Die WLAN-Kamera aus dem Überraschungsei

IT-Gipfel 2014: De Maizière nennt De-Mail "nicht ganz zufriedenstellend"
IT-Gipfel 2014
De Maizière nennt De-Mail "nicht ganz zufriedenstellend"
  1. Digitale Agenda 38 Seiten Angst vor festen Zusagen
  2. E-Mail Ende-zu-Ende-Verschlüsselung für Yahoo Mail

Retro-Netzwerk: Der Tilde.Club erstellt Webseiten wie in den Neunzigern
Retro-Netzwerk
Der Tilde.Club erstellt Webseiten wie in den Neunzigern

    •  / 
    Zum Artikel