Wissenschaft: Yahoo verkauft in Japan Gentests
Gene Life 2012: Auswertung und Hinweise für Lebensführung (Bild: Yahoo/Screenshot: Golem.de)

Wissenschaft Yahoo verkauft in Japan Gentests

Der Internetkonzern Yahoo steigt in Japan in das Geschäftsfeld Gesundheit ein: Das Unternehmen bietet zusammen mit einem Partner Gentests in dem asiatischen Land an.

Anzeige

Die Gentests für jedermann kommen voraussichtlich im Dezember in Japan auf den Markt. Mit ihrer Hilfe sollen die Käufer feststellen können, ob sie eine Disposition für bestimmte Krankheiten haben.

Die Käufer von Gene Life 2012 nehmen eine Speichelprobe und schicken sie an Genesis Healthcare, ein in Tokio ansässiges Unternehmen, das auf Gentests spezialisiert ist. Genesis Healthcare untersuche dann 68 Gene auf die Disposition von Krankheiten wie Diabetes, Schlaganfall oder Herzkrankheiten, berichtet die Tageszeitung Japan Times.

Auswertung und Hinweise

Die Nutzer erhalten von dem Unternehmen nach etwa zwei Monaten eine Auswertung des Tests. Außerdem werden Hinweise mitgeliefert, wie die Probanden ihr Leben so führen, dass sie das Risiko des Ausbruchs einer der Krankheiten verringern können.

Der Test soll rund 30.000 Yen, umgerechnet knapp 300 Euro, kosten. Yahoo will 300 Tests pro Monat absetzen. Der Konzern wird lediglich die Vermarktung übernehmen und mit den Gentests selbst nichts zu tun haben.


pholem 06. Nov 2012

Ahja, danke. http://www.heise.de/newsticker/meldung/Das-vermessene-Ich-Koerper-und...

attitudinized 03. Nov 2012

Also ich finde "Kunden mit Sequenz GATAAATCTGGTCTTTATTCC haben auch (...)gekauft." besser ;-)

Kommentieren



Anzeige

  1. Software-Entwickler (m/w)
    windream GmbH, Bochum
  2. (Senior) Consultant Business Intelligence SAP BW (m/w)
    MAS Software GmbH, München
  3. Software Supporter (m/w) für den internationalen Kunden HelpDesk
    TONBELLER AG, Bensheim
  4. Senior Manager of ICT Services EMEA (m/w)
    Bosch Communication Center Magdeburg GmbH, Magdeburg

 

Detailsuche


Folgen Sie uns
       


  1. Displays und Kameras

    Für die Pixelzähler

  2. Norton Security

    Symantec bestätigt Ende von Norton Antivirus

  3. Streaming

    Adam Sandler produziert vier Filme nur für Netflix

  4. Googles nächstes Smartphone

    Neue Details zum kommenden Nexus 6

  5. Freisprecheinrichtung

    Erst iOS 8.1 soll Bluetooth-Probleme im Auto lösen

  6. Toughbook CF-LX3

    Panasonics leichtes Notebook mit der Lizenz zum Runterfallen

  7. Honda Connect

    Nvidias Tegra fährt mit Android in Japan

  8. Smartphones

    Sonys Xperia Z3 und Xperia Z3 Compact sind da

  9. Pavlok

    Gewollte Stromschläge vom Fitness-Wearable

  10. Apple

    iOS hat noch immer WLAN-Probleme



Haben wir etwas übersehen?

E-Mail an news@golem.de



In eigener Sache: Golem.de offline und unplugged
In eigener Sache
Golem.de offline und unplugged
  1. Golem pur Golem.de startet werbefreies Abomodell
  2. In eigener Sache Golem.de definiert sich selbst

Ello: Das Anti-Facebook, nächster Versuch
Ello
Das Anti-Facebook, nächster Versuch
  1. Soziale Netzwerke Offline-Freund bleibt wichtiger als Online-Freund
  2. Soziale Netzwerke Beschäftigte wollen nicht mit dem Chef befreundet sein
  3. Echtzeit-Überwachung BND prüft angeblich Einsatz von SAPs Hana-Datenbank

Elektromagnetik: Der Dietrich für den Dieb von heute
Elektromagnetik
Der Dietrich für den Dieb von heute

    •  / 
    Zum Artikel