Abo
  • Services:
Anzeige
Gene Life 2012: Auswertung und Hinweise für Lebensführung
Gene Life 2012: Auswertung und Hinweise für Lebensführung (Bild: Yahoo/Screenshot: Golem.de)

Wissenschaft: Yahoo verkauft in Japan Gentests

Gene Life 2012: Auswertung und Hinweise für Lebensführung
Gene Life 2012: Auswertung und Hinweise für Lebensführung (Bild: Yahoo/Screenshot: Golem.de)

Der Internetkonzern Yahoo steigt in Japan in das Geschäftsfeld Gesundheit ein: Das Unternehmen bietet zusammen mit einem Partner Gentests in dem asiatischen Land an.

Die Gentests für jedermann kommen voraussichtlich im Dezember in Japan auf den Markt. Mit ihrer Hilfe sollen die Käufer feststellen können, ob sie eine Disposition für bestimmte Krankheiten haben.

Die Käufer von Gene Life 2012 nehmen eine Speichelprobe und schicken sie an Genesis Healthcare, ein in Tokio ansässiges Unternehmen, das auf Gentests spezialisiert ist. Genesis Healthcare untersuche dann 68 Gene auf die Disposition von Krankheiten wie Diabetes, Schlaganfall oder Herzkrankheiten, berichtet die Tageszeitung Japan Times.

Anzeige

Auswertung und Hinweise

Die Nutzer erhalten von dem Unternehmen nach etwa zwei Monaten eine Auswertung des Tests. Außerdem werden Hinweise mitgeliefert, wie die Probanden ihr Leben so führen, dass sie das Risiko des Ausbruchs einer der Krankheiten verringern können.

Der Test soll rund 30.000 Yen, umgerechnet knapp 300 Euro, kosten. Yahoo will 300 Tests pro Monat absetzen. Der Konzern wird lediglich die Vermarktung übernehmen und mit den Gentests selbst nichts zu tun haben.


eye home zur Startseite
pholem 06. Nov 2012

Ahja, danke. http://www.heise.de/newsticker/meldung/Das-vermessene-Ich-Koerper-und...

attitudinized 03. Nov 2012

Also ich finde "Kunden mit Sequenz GATAAATCTGGTCTTTATTCC haben auch (...)gekauft." besser ;-)



Anzeige

Stellenmarkt
  1. Teradata GmbH, München, Düsseldorf oder Frankfurt
  2. EVI Audio GmbH, Straubing
  3. Cpro Industry Projects & Solutions GmbH, verschiedene Einsatzorte
  4. Cassini AG, München, Stuttgart


Anzeige
Blu-ray-Angebote
  1. 149,99€ (Vorbesteller-Preisgarantie)

Folgen Sie uns
       


  1. Up- und Download

    Breites Bündnis ruft nach flächendeckender Gbit-Versorgung

  2. Kurznachrichtendienst

    Twitter bewertet sich mit 30 Milliarden US-Dollar

  3. Microsoft

    Besucher können die Hololens im Kennedy Space Center nutzen

  4. MacOS 10.12

    Fujitsu warnt vor der Nutzung von Scansnap unter Sierra

  5. IOS 10.0.2

    Apple beseitigt Ausfälle der Lightning-Audio-Kontrollen

  6. Galaxy Note 7

    Samsung tauscht das Smartphone vor der Haustür aus

  7. Falcon-9-Explosion

    SpaceX grenzt Explosionsursache ein

  8. Die Woche im Video

    Schneewittchen und das iPhone 7

  9. 950 Euro

    Abmahnwelle zu Pornofilm-Filesharing von Betrügern

  10. Jailbreak

    19-Jähriger will iPhone-7-Exploit für sich behalten



Haben wir etwas übersehen?

E-Mail an news@golem.de


Anzeige
Interview mit Insider: Facebook hackt Staat und Gemeinschaft
Interview mit Insider
Facebook hackt Staat und Gemeinschaft
  1. Nach Whatsapp-Datentausch Facebook und Oculus werden enger zusammengeführt
  2. Facebook 64 Die iOS-App wird über 150 MByte groß
  3. Datenschutz bei Facebook EuGH soll Recht auf Sammelklage prüfen

AGL-Meeting in München: Einheitliches Linux im Auto hilft den Herstellern
AGL-Meeting in München
Einheitliches Linux im Auto hilft den Herstellern
  1. Nouveau Nvidias Verhalten gefährdet freien Linux-Treiber
  2. 25 Jahre Linux Besichtigungstour zu den skurrilsten Linux-Distributionen
  3. Hans de Goede Red-Hat-Entwickler soll Hybridgrafik unter Linux verbessern

iOS 10 im Test: Klügere Apps, Herzchen und ein sinnvoller Sperrbildschirm
iOS 10 im Test
Klügere Apps, Herzchen und ein sinnvoller Sperrbildschirm
  1. Betaversion iOS 10.1 Beta enthält Porträt-Modus für iPhone 7 Plus
  2. Apple Nutzer berichten über verschiedene Probleme mit dem iPhone 7
  3. Apple Startprobleme beim Update auf iOS 10

  1. Und im Klartext?

    gaciju | 20:56

  2. Re: Trump und Clinton sind beide eine große...

    fb_partofmilitc... | 20:53

  3. Finales Statement von OP

    pismo | 20:52

  4. Re: AMD hat bei Grafiktreibern aus seinen Fehlern...

    gaciju | 20:51

  5. Re: Ist Golem etwa für Shrillary?

    fb_partofmilitc... | 20:51


  1. 15:10

  2. 13:15

  3. 12:51

  4. 11:50

  5. 11:30

  6. 11:13

  7. 11:03

  8. 09:00


  1. Themen
  2. A
  3. B
  4. C
  5. D
  6. E
  7. F
  8. G
  9. H
  10. I
  11. J
  12. K
  13. L
  14. M
  15. N
  16. O
  17. P
  18. Q
  19. R
  20. S
  21. T
  22. U
  23. V
  24. W
  25. X
  26. Y
  27. Z
  28. #
 
    •  / 
    Zum Artikel