Wissenschaft: Yahoo verkauft in Japan Gentests
Gene Life 2012: Auswertung und Hinweise für Lebensführung (Bild: Yahoo/Screenshot: Golem.de)

Wissenschaft Yahoo verkauft in Japan Gentests

Der Internetkonzern Yahoo steigt in Japan in das Geschäftsfeld Gesundheit ein: Das Unternehmen bietet zusammen mit einem Partner Gentests in dem asiatischen Land an.

Anzeige

Die Gentests für jedermann kommen voraussichtlich im Dezember in Japan auf den Markt. Mit ihrer Hilfe sollen die Käufer feststellen können, ob sie eine Disposition für bestimmte Krankheiten haben.

Die Käufer von Gene Life 2012 nehmen eine Speichelprobe und schicken sie an Genesis Healthcare, ein in Tokio ansässiges Unternehmen, das auf Gentests spezialisiert ist. Genesis Healthcare untersuche dann 68 Gene auf die Disposition von Krankheiten wie Diabetes, Schlaganfall oder Herzkrankheiten, berichtet die Tageszeitung Japan Times.

Auswertung und Hinweise

Die Nutzer erhalten von dem Unternehmen nach etwa zwei Monaten eine Auswertung des Tests. Außerdem werden Hinweise mitgeliefert, wie die Probanden ihr Leben so führen, dass sie das Risiko des Ausbruchs einer der Krankheiten verringern können.

Der Test soll rund 30.000 Yen, umgerechnet knapp 300 Euro, kosten. Yahoo will 300 Tests pro Monat absetzen. Der Konzern wird lediglich die Vermarktung übernehmen und mit den Gentests selbst nichts zu tun haben.


pholem 06. Nov 2012

Ahja, danke. http://www.heise.de/newsticker/meldung/Das-vermessene-Ich-Koerper-und...

attitudinized 03. Nov 2012

Also ich finde "Kunden mit Sequenz GATAAATCTGGTCTTTATTCC haben auch (...)gekauft." besser ;-)

Kommentieren



Anzeige

  1. Technischer Redakteur (m/w) für Softwaredokumentation
    Teradata GmbH, München
  2. Senior UX/UI Designer für Web & Mobile Apps (m/w)
    24-7 Entertainment GmbH, Berlin
  3. Gruppenleiter (m/w) für Software-Qualitätsmanagement
    TRUMPF GmbH + Co. KG, Ditzingen bei Stuttgart
  4. Inhouse Spezialist SAP (m/w)
    ROTA YOKOGAWA GmbH & Co. KG, Wehr am Rhein

 

Detailsuche


Folgen Sie uns
       


  1. Pangu 1.0.1

    Jailbreak für iOS 8.1

  2. Gratiseinwilligung für Google

    Verlage knicken beim Leistungsschutzrecht ein

  3. John Riccitiello

    Ex-EA-Chef ist neuer Boss von Unity Technologies

  4. Android Wear

    Moto 360 und G Watch erhalten Update

  5. Digitale Dividende II

    Bundesnetzagentur will DVB-T ab April 2015 beenden

  6. Security

    Gefährliche Schwachstellen im UEFI-Bios

  7. Broadcom

    Chips für Router mit G.Fast sind fertig

  8. Canon Filmkamera

    EOS C100 Mark II mit Dual-Pixel-AF und besserem Sucher

  9. Samsung

    Galaxy-Geräte mit Knox für US-Regierung zertifiziert

  10. Sammelkarten

    Hearthstone erst 2015 auf Smartphones



Haben wir etwas übersehen?

E-Mail an news@golem.de



Schenker XMG P505 im Test: Flaches Gaming-Notebook mit überraschender GTX 970M
Schenker XMG P505 im Test
Flaches Gaming-Notebook mit überraschender GTX 970M
  1. Geforce GTX 980M und 970M Maxwell verdoppelt Spielgeschwindigkeit von Notebooks
  2. Toughbook CF-LX3 Panasonics leichtes Notebook mit der Lizenz zum Runterfallen
  3. Entwicklung vorerst eingestellt Notebooks mit Touch-Displays sind nicht gefragt

Legale Streaming-Anbieter im Test: Netflix allein macht auch nicht glücklich
Legale Streaming-Anbieter im Test
Netflix allein macht auch nicht glücklich
  1. Netflix-Statistik Die Schweiz streamt am schnellsten
  2. Deutsche Telekom Entertain ab dem 14. Oktober mit Netflix
  3. HTML5-Videostreaming Netflix bietet volle Linux-Unterstützung

Windows 10 Technical Preview ausprobiert: Die Sonne scheint aufs Startmenü
Windows 10 Technical Preview ausprobiert
Die Sonne scheint aufs Startmenü
  1. Build 9860 Windows 10 jetzt mit Info-Center für Benachrichtigungen
  2. Microsoft Neue Fensteranimationen für Windows 10
  3. Windows 10 Microsoft will nicht an das unbeliebte Windows 8 erinnern

    •  / 
    Zum Artikel