Gene Life 2012: Auswertung und Hinweise für Lebensführung
Gene Life 2012: Auswertung und Hinweise für Lebensführung (Bild: Yahoo/Screenshot: Golem.de)

Wissenschaft Yahoo verkauft in Japan Gentests

Der Internetkonzern Yahoo steigt in Japan in das Geschäftsfeld Gesundheit ein: Das Unternehmen bietet zusammen mit einem Partner Gentests in dem asiatischen Land an.

Anzeige

Die Gentests für jedermann kommen voraussichtlich im Dezember in Japan auf den Markt. Mit ihrer Hilfe sollen die Käufer feststellen können, ob sie eine Disposition für bestimmte Krankheiten haben.

Die Käufer von Gene Life 2012 nehmen eine Speichelprobe und schicken sie an Genesis Healthcare, ein in Tokio ansässiges Unternehmen, das auf Gentests spezialisiert ist. Genesis Healthcare untersuche dann 68 Gene auf die Disposition von Krankheiten wie Diabetes, Schlaganfall oder Herzkrankheiten, berichtet die Tageszeitung Japan Times.

Auswertung und Hinweise

Die Nutzer erhalten von dem Unternehmen nach etwa zwei Monaten eine Auswertung des Tests. Außerdem werden Hinweise mitgeliefert, wie die Probanden ihr Leben so führen, dass sie das Risiko des Ausbruchs einer der Krankheiten verringern können.

Der Test soll rund 30.000 Yen, umgerechnet knapp 300 Euro, kosten. Yahoo will 300 Tests pro Monat absetzen. Der Konzern wird lediglich die Vermarktung übernehmen und mit den Gentests selbst nichts zu tun haben.


pholem 06. Nov 2012

Ahja, danke. http://www.heise.de/newsticker/meldung/Das-vermessene-Ich-Koerper-und...

attitudinized 03. Nov 2012

Also ich finde "Kunden mit Sequenz GATAAATCTGGTCTTTATTCC haben auch (...)gekauft." besser ;-)

Kommentieren



Anzeige

  1. Produktmanager SEO (m/w)
    Computec Media GmbH, Fürth
  2. Information Security Principal Consultant (m/w)
    QRC Group, München
  3. Senior Software Entwickler C++/IT-Architekt (m/w)
    MVI PROPLANT Süd GmbH, München
  4. Mitarbeiter Business Intelligence (m/w)
    Flughafen Düsseldorf GmbH, Düsseldorf

 

Detailsuche


Hardware-Angebote
  1. VORBESTELLBAR: Fire TV Stick
    39,00€ - Release 15.04.
  2. TOPSELLER BEI ALTERNATE: G.Skill DIMM 8 GB DDR3-1600 Kit
    59,90€
  3. ARCTIC Freezer 13 CO (mit 92mm PWM-Lüfter, für AMD u. Intel)
    26,19€ inkl. Versand

 

Weitere Angebote


Folgen Sie uns
       


  1. Volvo Lifepaint

    Reflektorfarbe aus der Dose schützt Radfahrer

  2. Projekt-Hosting

    Tagelanger DDoS-Angriff auf Github

  3. Samsung

    Galaxy S4 bekommt Lollipop

  4. Deutsche Bahn

    WLAN im Nahverkehr in einigen Jahren

  5. Lords of the Fallen

    Partner wirft Deck 13 "mangelhafte Ausführung" vor

  6. Galaxy S6 Edge im Test

    Keine ganz runde Sache

  7. Biohacking

    Nachtsicht wie ein Tiefseefisch

  8. Spielebranche

    Betrugsvorwürfe gegen Zynga

  9. Adaptalux

    Lichtschwanenhälse sollen winzige Fotodetails ausleuchten

  10. Illegale Onlinemärkte

    Mutmaßlicher Betreiber des Sheep Marketplace verhaftet



Haben wir etwas übersehen?

E-Mail an news@golem.de



Raspberry Pi 2: Die Feierabend-Maschine
Raspberry Pi 2
Die Feierabend-Maschine
  1. GCHQ Bastelnde Spione bauen Raspberry-Pi-Cluster
  2. Raspberry Pi 2 Fotografieren nur ohne Blitz
  3. Internet der Dinge Windows 10 läuft kostenlos auf dem Raspberry Pi 2

Gnome 3.16 angesehen: "Tod der Nachrichtenleiste"
Gnome 3.16 angesehen
"Tod der Nachrichtenleiste"
  1. Server-Technik Gnome erstellt App-Sandboxes
  2. Display-Server Volle Wayland-Unterstützung für Gnome noch dieses Jahr
  3. Linux Gnome-Werkzeug soll für bessere Akkulaufzeiten sorgen

Openstack: Viele brauchen es, keiner versteht es - wir erklären es
Openstack
Viele brauchen es, keiner versteht es - wir erklären es
  1. Cebit 2015 Das Open Source Forum debattiert über Limux

  1. Re: 24p

    spyro2000 | 14:51

  2. Re: Von Rechts wegen...

    plutoniumsulfat | 14:50

  3. Re: Erinnert das Noch jemand an MinorityReport?

    Butterkeks | 14:49

  4. Jetzt mal ernsthaft Golem!

    Raptor007 | 14:48

  5. Re: Vollidiot.....

    chefin | 14:48


  1. 14:50

  2. 13:48

  3. 12:59

  4. 12:48

  5. 12:29

  6. 12:03

  7. 12:00

  8. 11:50


  1. Themen
  2. A
  3. B
  4. C
  5. D
  6. E
  7. F
  8. G
  9. H
  10. I
  11. J
  12. K
  13. L
  14. M
  15. N
  16. O
  17. P
  18. Q
  19. R
  20. S
  21. T
  22. U
  23. V
  24. W
  25. X
  26. Y
  27. Z
  28. #
 
    •  / 
    Zum Artikel