Gene Life 2012: Auswertung und Hinweise für Lebensführung
Gene Life 2012: Auswertung und Hinweise für Lebensführung (Bild: Yahoo/Screenshot: Golem.de)

Wissenschaft Yahoo verkauft in Japan Gentests

Der Internetkonzern Yahoo steigt in Japan in das Geschäftsfeld Gesundheit ein: Das Unternehmen bietet zusammen mit einem Partner Gentests in dem asiatischen Land an.

Anzeige

Die Gentests für jedermann kommen voraussichtlich im Dezember in Japan auf den Markt. Mit ihrer Hilfe sollen die Käufer feststellen können, ob sie eine Disposition für bestimmte Krankheiten haben.

Die Käufer von Gene Life 2012 nehmen eine Speichelprobe und schicken sie an Genesis Healthcare, ein in Tokio ansässiges Unternehmen, das auf Gentests spezialisiert ist. Genesis Healthcare untersuche dann 68 Gene auf die Disposition von Krankheiten wie Diabetes, Schlaganfall oder Herzkrankheiten, berichtet die Tageszeitung Japan Times.

Auswertung und Hinweise

Die Nutzer erhalten von dem Unternehmen nach etwa zwei Monaten eine Auswertung des Tests. Außerdem werden Hinweise mitgeliefert, wie die Probanden ihr Leben so führen, dass sie das Risiko des Ausbruchs einer der Krankheiten verringern können.

Der Test soll rund 30.000 Yen, umgerechnet knapp 300 Euro, kosten. Yahoo will 300 Tests pro Monat absetzen. Der Konzern wird lediglich die Vermarktung übernehmen und mit den Gentests selbst nichts zu tun haben.


pholem 06. Nov 2012

Ahja, danke. http://www.heise.de/newsticker/meldung/Das-vermessene-Ich-Koerper-und...

attitudinized 03. Nov 2012

Also ich finde "Kunden mit Sequenz GATAAATCTGGTCTTTATTCC haben auch (...)gekauft." besser ;-)

Kommentieren



Anzeige

  1. Software-Tester / Test­manager (m/w)
    SOGETI Deutschland GmbH, verschiedene Standorte
  2. Leiter IT (CIO) (m/w)
    MKM Mansfelder Kupfer und Messing GmbH, Hettstedt bei Halle (Saale)
  3. Softwareentwickler Feldgeräteintegration (m/w)
    Festo AG & Co. KG, Denkendorf bei Stuttgart
  4. Entwicklungsingenieur (m/w) Software für den Bereich Firmware Smart-TV-Anwendung
    Metz Consumer Electronics GmbH, Zirndorf Raum Nürnberg

Detailsuche


Top-Angebote
  1. NEU: 4 Blu-rays für 30 EUR
    (u. a. Interstellar, Grand Budapest Hotel, Teenage Mutant Ninja Turtles, Django Unchained, Edge of...
  2. NEU: Fast & Furious 7 - Extended Version (inkl. Digital Ultraviolet) [Blu-ray]
    14,99€
  3. TOP-PREIS: SAMSUNG UE55JU6050U, 138 cm (55 Zoll), UHD 4K, LED TV, , DVB-T, DVB-T2, DVB-C, DVB-S, DVB-S2
    799,00€ (im Preisvergleich sonst ab 1500,45€)

Weitere Angebote


Folgen Sie uns
       


  1. Lenovo Yoga Tab 3 Pro

    10-Zoll-Tablet mit eingebautem 70-Zoll-Projektor

  2. Smartwatches

    Motorola stellt neue Moto 360 und Moto 360 Sport vor

  3. Umfrage

    Jeder vierte Nutzer hat Probleme beim Streaming

  4. Asus GX700

    Übertakter-Notebook läuft mit WaKü und geheimer Nvidia-GPU

  5. Testlauf

    Techniker Krankenkasse zahlt Ärzten Online-Videosprechstunde

  6. Mate S im Hands On

    Huawei präsentiert Smartphone mit Force-Touch-Display

  7. Smartwatch

    Huawei Watch kostet so viel wie Apple Watch

  8. Sonys Xperia-Z5-Modellreihe im Hands on

    Das erste Smartphone mit 4K-Display

  9. Für unterwegs und Homeoffice

    Telekom bietet den neuen Service "One Number"

  10. Copyrightstreit um Happy Birthday

    Kinderlieder gegen Time Warner



Haben wir etwas übersehen?

E-Mail an news@golem.de



Until Dawn im Test: Ich weiß, was du diesen Sommer spielen solltest
Until Dawn im Test
Ich weiß, was du diesen Sommer spielen solltest
  1. The Flock im Test Versteck spielen, bis alle tot sind
  2. Everybody's Gone to the Rapture im Test Spaziergang am Rande der Apokalypse
  3. Submerged im Test Einschläferndes Abenteuer

Uberchord ausprobiert: Besser spielen statt Highscore jagen
Uberchord ausprobiert
Besser spielen statt Highscore jagen
  1. Generationen-Fernsehen Sony-Lautsprecher ist zugleich Fernbedienung fürs TV
  2. Satellit Neuer 4K-Demokanal bei SES Astra
  3. DAB+ WDR schaltet seine Mittelwellensender ab

Autonomes Fahren: Auf dem Highway ist das Lenkrad los
Autonomes Fahren
Auf dem Highway ist das Lenkrad los
  1. Autonomes Fahren Googles Mini-Autos sollen auf Wildwechsel reagieren können
  2. Fixie Radfahrer irritiert autonomes Google-Auto
  3. Autonome Autos Daimler würde mit Google oder Apple kooperieren

  1. Re: Man merkte an der Serifenschrift dass die...

    exxo | 04:09

  2. Re: Im Grunde nix anderes als Waze

    Atalanttore | 04:00

  3. Wer will schon ein vernetztes Fahren?

    Atalanttore | 03:52

  4. Re: Und Tschüss ....

    Galde | 03:49

  5. Mit dem autonomen Fahrzeug durch Wanderbaustellen...

    Atalanttore | 03:39


  1. 22:20

  2. 21:45

  3. 21:17

  4. 18:20

  5. 17:49

  6. 17:43

  7. 17:24

  8. 16:45


  1. Themen
  2. A
  3. B
  4. C
  5. D
  6. E
  7. F
  8. G
  9. H
  10. I
  11. J
  12. K
  13. L
  14. M
  15. N
  16. O
  17. P
  18. Q
  19. R
  20. S
  21. T
  22. U
  23. V
  24. W
  25. X
  26. Y
  27. Z
  28. #
 
    •  / 
    Zum Artikel